Answer:
d. sampling unit
Explanation:
<u>Sampling unit:</u>
Refers to the unit or group of elements that are selected from an original population during an investigation. The sampling unit might be composed of a statistical unit or a group of statistical units.
The statistical unit or element is the elemental unit that composes the target population.
The sampling unit is a basic concept to keep present during the development of the investigation project. It is the minimal unit of observation that will be used to take information about the variables of interest. All the sample unit composes the population and is defined by an <em>N</em>, while only some representative sample units compose the sample, and are represented with an <em>n</em>.
So, the whole population can not be measured because of its size, or the individuals´ characteristics, among other many factors. So we need to take a random and representative sample or group of the population to proceed with our investigation. This sample or group is composed of some of the original population individuals, which are defined as "sample units".
The answer is A: Mass extinction.
"Abrupt disappearance of many land and marine species" = extinction of many species.
Answer:
oxygen , carbon , hydrogen , nitrogen , phosphorus , sulfur are some examples
Diatoms contain chloroplasts that have four membranes. These four membranes are evidence of secondary endosymbiosis (Option c).
<h3>What is secondary endosymbiosis?</h3>
Secondary endosymbiosis is a hypothesis used to explain why diatom chloroplasts have four membranes.
According to this hypothesis, diatoms received different genes from distinct photosynthetic and non-photosynthetic ancestors.
The acquisition of genes of different ancestors led to diatoms having chloroplasts with four membranes.
Learn more about the endosymbiosis hypothesis here:
brainly.com/question/2957447
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
