1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Grace [21]
3 years ago
7

What is the third step in cellular respiration? (1 point)

Biology
1 answer:
Dafna1 [17]3 years ago
6 0
Electron transport chain
You might be interested in
1.Paramecium was found to occupy 20% of the FOV of a microscope at 40X magnification power. How many paramecium can be accommoda
7nadin3 [17]

Answer:

Five (5)

Explanation:

A <u>total of five (5) paramecia </u>can be accommodated within the FOV.

The field of view of a microscope represents the area of the visible region under the ocular/eyepiece at a specific magnification. In other words, the diameter of the circular area visible through the ocular of the microscope at a specific magnification represents the field of view.

<em>If a paramecium was found to occupy 20% of the total field of view of a microscope at X40 magnification, then the total number of paramecia that can be accommodated within the field would be:</em>

     100/20 = 5 paramecia

6 0
3 years ago
What are the steps for DNA amplification process/experiment?<br><br> Please help me <br> Thanks
spayn [35]
(1) denaturation of the template into single strands; (2) annealing of primers to each original strand for new strand synthesis; and (3) extension of the new DNA strands from the primers.

Hope this helps! :)
5 0
3 years ago
Which of the following is not a function of enzymes
cestrela7 [59]

C) Provide insulation.

Enzymes are catalyst, meaning that the speed up and help during chemical reaction which in turn means that they do prodvide energy to the cell, they do assist in the production of new cell parts and they also control many cell processes.

They do not provide insulation to cells, and that is the function of lipids.



Hope it helped,



BioTeacher101

6 0
3 years ago
Read 2 more answers
What are the Amino acids of the mutated DNA sequence: TAC ATC TTG GCG ACG ACT
Natali5045456 [20]

Answer:

Tyr Ile Leu Ala Thr Thr

Explanation:

In a DNA sequence, a pair of three bases form a codon that codes one particular amino acid in the protein. Proteins are consist of  20 amino acids and these amino acids are coded by a pair of three bases.  

There are four bases in a DNA - Thymine (T), Adenine(A), Guanine(G) and Cytosine(C).

The given mutated DNA sequence will also code for some amino acid, that is as follows:

TAC - Tyr (Tyrosine)

ATC - Ile (Isoleucine)

TTG -  Leu (Leucine)

GCG - Ala (Alanine)

ACG - Thr (Threonine)

ACT - Thr (Threonine)

Thus, The mutated DNA sequence  TAC ATC TTG GCG ACG ACT codes for Tyr Ile Leu Ala Thr Thr.

6 0
3 years ago
Why is charles darwin's book on the origin of species (1859) considered an important contribution to modern science?
bija089 [108]

it synthesized information from diverse scientific fields in order to document evolutionary change.

5 0
3 years ago
Other questions:
  • What is the source of all animal energy of the earth
    11·2 answers
  • The health care provider (hcp) prescribes iv cefazolin 1 g for a client. in preparing to administer the cefazolin, the nurse not
    12·2 answers
  • A scientist finds what she thinks is a new species of rodent on a small Pacific island. However, some similar-looking rodents in
    9·2 answers
  • Cell Division There are two types of cell division. The first (A) produces cells that are identical to the original cell. The se
    12·2 answers
  • What type of weathering produces karst topography?
    12·2 answers
  • How does a virus cause disease?
    13·1 answer
  • In what direction do global winds and currents flow south of the equator? a. east to west c. toward the land b. west to east d.
    5·1 answer
  • A greenhouse that specializes in growing vegetables used for Chinese cooking is divided into sections. The number of plants in e
    11·1 answer
  • Do you believe you have a personal responsibility to protect the environment
    11·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!