1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
polet [3.4K]
3 years ago
12

A man was accused of attacking another man. He was brought into police custody and interrogated for 2 hours. Prior to the interr

ogation, he was never informed that he had the right to remain silent or to have a lawyer present. During the interrogation, he signed a confession. What type of law does this represent?
Law
2 answers:
NARA [144]3 years ago
7 0

Answer:

the 5th amendment

Explanation:

VladimirAG [237]3 years ago
5 0

Answer:

self incrimantion

Explanation:

You might be interested in
This refers to the process of a person admitting to guilt in a criminal or civil case, often in the hopes of receiving a lesser
SpyIntel [72]

Answer:

guilty plea

Explanation:

6 0
3 years ago
Read 2 more answers
What governmental policy could be developed to avoid funneling low-income defendants in the criminal justice system for the sake
Umnica [9.8K]
Developers could be avoid
7 0
2 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
I need brainly to email me back ASAP.
OLEGan [10]

Hey there,

Brainly is a website ran by a large team of people but they are also frequently busy. Please do be patient while their team gets back to you, they are people just like you and I.

Please have a good day. :)

3 0
3 years ago
Read 2 more answers
Similarities between arbitration and mediation?
galina1969 [7]
Mediation and arbitration are similar in that they bring together parties in conflict to resolve an issue outside of the courtroom, but each has its own unique way of doing so. Mediation is an alternative process for conflict resolution that provides a number of advantages over going to court.
6 0
2 years ago
Other questions:
  • Jerome joined the police force a few months back. His seniors have sent him to investigate his very first crime scene. According
    5·2 answers
  • Which action can Congress not perform, according to the Constitution?
    11·2 answers
  • Match each method for creating domestic policy with its definition.
    9·1 answer
  • A school district supplied school bus service for all children 12 years of age or under who lived at least one mile from school.
    5·1 answer
  • 3 points
    7·1 answer
  • What's is this question answer it please
    9·2 answers
  • How long is a representative's term of office?
    9·2 answers
  • Why might a social epidemiologist study the mass media?
    12·2 answers
  • What are three arguments in made in the masterpiece cakeshop v. colorado civil rights commission?
    13·1 answer
  • If you are to comply with Medicare’s guidance regarding educational events, which of the following would be acceptable activitie
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!