1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fudgin [204]
3 years ago
10

Hi! For those of you that need help with questions about Diabetes, I am type 1 diabetic so you can ask me and I shall answer :)

^^​
Health
1 answer:
7nadin3 [17]3 years ago
3 0

what's it like with Diabetes

You might be interested in
Which of the following is an example of a complex carbohydrate? A. Whole-grain bread. B. Popcorn.
Finger [1]

Answer:

D. All the above

Explanation:

I majored in Health

3 0
3 years ago
Read 2 more answers
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
s2008m [1.1K]

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

5 0
3 years ago
Corey begins to realize he has a problem. He calls the National Eating Disorders Association’s hotline at 1-800-931-2237 to ask
Oliga [24]

Answer:

A, C, D

Explanation: I just took the assessment.

7 0
3 years ago
Read 2 more answers
True or False? <br> Family, friends, and help lines are examples of support for eating disorders.
Lubov Fominskaja [6]

Answer:

True

Explanation:

They are very useful when it comes to encouragement and support.

hope this helps :)

8 0
3 years ago
Read 2 more answers
Why do you think athletes often eat lots of carbohydrates the day before a competition?
Dmitriy789 [7]
Carbohydrates are in place of simple sugars and complex carbs which either are quick energy or stored energy for performance.  Without carbs, the body will shut down because you need sufficient energy to keep going.  Carbs are what keeps you moving and functioning.
3 0
4 years ago
Other questions:
  • Suppose a beaker of solid reagent drops onto the bench and cracks. Which of the following represents the correct disposal: Selec
    14·1 answer
  • Which statement about trans-fatty acids is FALSE?
    6·1 answer
  • Following WWII a new awareness of the importance of physical fitness emerged.
    6·1 answer
  • Which of the following best describes the type of industry that health care falls into? manufacturing , service, production , te
    10·2 answers
  • Why are some people white and some people dark. is it due to our ancesters and why did the children also come out that way?
    6·1 answer
  • How many amino acids are there
    10·2 answers
  • Please help me ASAP
    13·1 answer
  • How long does it take for average sized male to remove all the alcohol from from their body from 1 drink
    15·2 answers
  • Why do people break away that easily?​
    14·1 answer
  • Which controls would be more important to chipotle: feedforward , concurrent,or feedback? Explain
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!