1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BaLLatris [955]
3 years ago
8

you are assembling desserts with a friend together you can make 12 desserts in 5 minutes. how many can you make in 20 minutes?

Mathematics
1 answer:
Sever21 [200]3 years ago
3 0
You can solve this in two ways.

First way:
Let’s find out how many my friend makes in one minute.
12/5=2.4
He makes 2.4 in one minute. Let’s multiply that by 20 to find what he makes in 20 minutes.
2.4•20=48
My friend made 48 desserts.

Second way:
Let’s make a ratio.
12 desserts:5 minutes
X desserts: 20 minutes
Whatever you do to one side, you have to do to the other. Since you are multiplying the minutes by 4, you have to multiply the desserts by 4.
12•4=48

So, my friend made 48 desserts.
Tell me if this helps!!!
You might be interested in
The temperature is -2c. If the temperature rises by 15c what is the new temperature?
svetoff [14.1K]

Answer:

13c

Step-by-step explanation:

-2+15=13

13c

3 0
3 years ago
Read 2 more answers
Use algebraic rules of equations to predict the solution type to the system of equations. Include all of your work for full cred
Tasya [4]

y=-4-x

y=2x-1


-4-x=2x-1

3x=-3

x=-1

y=-3


The type of equation is consistent because they intersect at ( -1,-3 )



8 0
3 years ago
Read 2 more answers
He gave out half of the cookies in the morning. At lunch, he gave out 14 more. He then had 8 cookies left. How many cookies did
Vsevolod [243]

Answer:

44 cookies

Step-by-step explanation:

add the remaining cookies to the ones he gave away

(8+14)=22

double that

22x2

answer

44

3 0
3 years ago
What is the volume of a hemisphere with a radius of 4.9 ft, rounded to the nearest
Alexxx [7]

Answer:

Step-by-step explanation:

To round 4.9 to nearest tenth means to round the numbers so you only have one digit in the fractional part. 4.9 already has only one digit in the fractional part. Thus, 4.9 is already rounded as much as possible to the nearest tenth and the answer is: 4.9

3 0
3 years ago
Read 2 more answers
Can someone help me with this?
Natalija [7]

use the Pythagoras theorem method

a squared plus b squared equals c square

8 0
3 years ago
Other questions:
  • Please help me with this!!!!!!!!!!
    11·1 answer
  • Ethan's taxable income is $87,525. Use this tax schedule to calculate the total amount he owes in taxes. $10,425.75 $18,617.75 $
    11·2 answers
  • When Han makes chocolate milk, he mixes 2 cups of milk with 3 tablespoons of chocolate syrup. Here is a table that shows how to
    12·1 answer
  • Laws of sines: the ambiguous case. I need help solving 3,6&9. Not sure what to do. Someone please help me
    8·1 answer
  • A grocery store has a discount of 13% off hand soap. At the same time, the hand soap manufacturer has a coupon for $2.00 off. As
    9·2 answers
  • The formula for the circumference, C, of a circle with radius r is given.
    12·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Explain how you could find the measurements of an enlargement if you know the ratio of the measurements of the original to the m
    10·1 answer
  • A local business charges $20 to set up their sweatshirt printing machine with the design and $9.75 in materials per sweatshirt t
    6·1 answer
  • 2. If you are paid time and a half for Saturday and double time for Sunday,
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!