Between 2015 and 2020, the rate of deforestation was estimated at 10 million hectares per year, down from 16 million hectares per year in the 1990s. The area of primary forest worldwide has decreased by over 80 million hectares since 1990.
Hope this helps!
The answer is B. Lysosome. Lysosomes break down old organelles and other unwanted materials. I hope this helps!
Answer:
The correct answer will be option-is read by ribosomes during the process of translation.
Explanation:
The DNA is a nucleic acid made up of nucleotides which serves as a genetic material of the cell. It stores the information required by the cell in the form of codons made up of nitrogenous bases. The DNA after transcription forms a messenger molecule called mRNA which is read by the ribosomes to code for specific amino acid which binds to form the proteins, the building block of the body.
Since the mRNA is read by the ribosomes during translation and not DNA directly, therefore, the selected option is the correct answer.
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Whales have horizontally positioned tales opposed to fish and they swim in an up and down type of motion to move, where as fish are the exact opposite flexing and turning their body left and right with their vertical tale to move.
Whales have bigger mouths to eat large schools of krill (their main source of food)
And also, whales are mammals, and breathe with their lungs, whereas fish use gills to breathe underwater. I hope this helped! Please mark Brainliest!
