1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
laila [671]
3 years ago
8

Individuals may pass on

Biology
2 answers:
maw [93]3 years ago
5 0
True because that means they are recessive genes
Rina8888 [55]3 years ago
3 0

Answer:

True

Explanation:

Two parents with recessive traits (a trait that is not on display) would create offspring with one dominant trait.

You might be interested in
Describe how plant fossils found at svalbard in norway gave evidence of drifting continents.
aleksley [76]

They were plants that preferred a warm temperature and couldn't survive in a cold one.

They discovered these plant fossils in Svalbard, Norway, which was once home to a forest. They were thought to have originated in a tropical jungle that was close to the equator. However, these fossils were discovered in the north, where the environment prevented their growth. This demonstrated that these trees were transported by continental drift to the northern, colder region that is now Norway.

learn more about fossils here:

brainly.com/question/6867325

#SPJ4

7 0
2 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Can somebody let me know the correct answer here?
Hitman42 [59]
The answer is A. I don’t have a reason for this hahahha sorry
6 0
3 years ago
All but which of the following can work against a viral infection
Arlecino [84]

The question is incomplete but antivirals, cells of the immune system and antibodies can work against viral infection.

<h3>What is a viral infection?</h3>

A viral infection is any disease caused by a virus that is able to infect and produce harm to a suitable host.

The immune system consists of different barriers to fight against viral infections, one of which is composed of immune cells and antibodies that work together to recognize and destroy pathogenic viruses.

For example, the cells that can work against a viral infection include cytotoxic T cells, macrophages and NK cells.

In conclusion, antivirals, cells of the immune system and antibodies can work against viral infection.

Learn more about viral infections here:

brainly.com/question/1554410

#SPJ1

6 0
2 years ago
Think about what you have had to eat lately, chances are you have enzymes in your body specifically designed to
Stella [2.4K]

Answer:

The human body uses three types of molecules to yield the necessary energy to drive ATP synthesis: fats, proteins, and carbohydrates.

Explanation:

Your welcome<3

Got it from www.nature.com

6 0
3 years ago
Other questions:
  • I need help please and thank you
    10·1 answer
  • All cells, both prokaryotic and eukaryotic, have all of the following except: A. cytoplasm B. DNA C. mitochondria D. ribosomes
    15·1 answer
  • What is it called when a cell has two copies of each chromosome.<br><br><br> in short sentence
    7·1 answer
  • Jack lives in a small city in the Pacific Northwest, where the temperatures are cool all year and the sky is frequently cloudy a
    5·2 answers
  • PLZ HELP QUICK!!!!!!!! WILL GIVE BRAINLIEST!!!!!!!!!!
    10·2 answers
  • Compared to most other substances, a great deal of heat is needed to raise the temperature of water by a given amount. This is b
    11·1 answer
  • Plzzz help <br> Explain how deforestation affects the carbon cycle
    5·1 answer
  • What are fossils? What do they tell us about the process of evolution?<br>​
    9·1 answer
  • How might male sex cells (contained in the pollen) get to the female sex cells (eggs) located in the ovary?
    11·1 answer
  • The process of copying an RNA strand is called
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!