1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BlackZzzverrR [31]
3 years ago
10

List the traits of each new species of rat.

Biology
1 answer:
True [87]3 years ago
3 0

Complete question:

Directions: Read the descriptions of the four islands presented in the lesson.

1. List two new traits that each new species of rat might demonstrate as it adapts to the conditions on each island.

2. Introduce one of the four new rat species to another island and describe one challenge it would encounter and one success as it adapts to its new environment

<u>Island A</u>:  

The island is fairly flat with an occasional hill. The ground is made of soft dirt, and several species of shrubs grow toward the center of the island. There is no animal life on land, but the water around the island is teeming with fish. The island is surrounded by a coral reef, and the shore is sandy with no algae growing on it. Freshwater is available.

The rat on Island A:

1.

2.

<u>Island B</u>:

This island has a rocky shoreline. Numerous tide pools dot the island along the shore where the wave action is somewhat sheltered by rocky outcrops. The tide pools host barnacles, abalone, sea urchins, and crabs. Algae grow all around the island; however, the growth of algae is quite sparse in the tide pools where the various animals feed. The current is quite strong along the rocky outcrops where the algae grow best. Freshwater is available.

The rat on Island B:

1.

2.

Island C:

The island is somewhat barren. A few species of cactus thrive on the bare rocks, and a large, cactus eating tortoise inhabits the island. A species of very large birds’ nests on the island annually. The birds build their nests on the rocks and protect their eggs from the sun by standing over the nests with outspread wings. The nests are always found on the windy side of the island, which is somewhat cooled by offshore breezes.

The rat on Island C:

1.

2.

Island D:

This island is an extinct volcano. Vegetation on the island changes as the altitude increases. Grasses grow at the base of the volcano, but farther up the volcano’s slope, the grasses give way to low shrubs. Halfway up, the island becomes quite lush; tropical plants and trees dominate the landscape. At this altitude, the island experiences frequent rain showers. Two species of birds inhabit the island. One is a raptor that preys on the smaller birds. The other fishes the waters approximately one mile offshore. Both of the bird species nest in trees.

The rat on Island D:

1.

2.

Answer:  

The rat on Island A:

1. Behavioural adaptation → Diurnal habits, as there are no predators that might attack them.      

2. <em>Morphological adaptation </em>→ Flat feet to move on the sand and Long strong nails to dig in the soft dirt and reach the roots of the shrubs which are a nutritious source of food.

The rat on Island B:

1.  Morphological adaptation → Strong extremities to move along the rocky shoreline, to avoid sudden wave impacts, and handle to swim counter-current if they fall.

2. Morphological adaptation → Strong mandibles, well-developed masseteric and temporal muscles, and teeth adapted to feed on barnacles, abalone, sea urchins, and crabs.

The rat on Island C:

1.  Stress-induced → Reduced transpiration rate due to the limited water availability.

2. Behavioural adaptation →  Skills to compete for scars food with the tortoise avoiding its attack or presence.  

The rat on Island D:

1.  Morphological adaptation → Waterproof coat, due to the frequent rain showers.

2. Morphological adaptation → Vestigial nails, as they do not need them to get food.  

<u>Introduction of a Rat from island C to island D</u>.

  • Challenge: They need to regulate water loss by increasing the transpiration rate. They need to grow fur adapted to excessive water.
  • Success: They are good competitors with special skills.

Explanation:

Due to technical problems, you will find the complete explanation in the attached files.

Download pdf
You might be interested in
When completing the water properties lab, which property of water was reasonable for the water molecules sticking to the penny?
BaLLatris [955]

Answer:

Water has adhesive force between it's molecules and the penny s molecules

Explanation:

Hope it helps

8 0
4 years ago
The vertical vessels that can be seen in the image extend throughout the tree, from its roots to its leaves. Which of the follow
Andru [333]

Answer:

Taking in and transporting water and nutrients

Explanation:

5 0
4 years ago
Some cells produce and secrete high levels of digestive proteins. Which organelles would you expect to be abundant in those cell
gizmo_the_mogwai [7]

Lysosomes are the organelles in charge of digesting and breaking down all matter in a cell that needs to be broken down, varying from food and energy molecules to viruses and bacteria.

7 0
4 years ago
This body of knowledge is an example of
ollegr [7]

Answer:

A body of knowledge is the accepted ontology for a specific domain. A BOK is more than simply a collection of terms; a professional reading list; a library; a website or a collection of websites; a description of professional functions; or even a collection of information.

Explanation:

dont know if this is right

5 0
3 years ago
Does commensalism involve abiotic factors or biotic factors ? ​
monitta

Answer:

Commensalism only occur among biotic factors

Explanation:

Abiotic factors are non-living factors that interacts with the biotic factor within an ecosystem. Commensalism is an association between two organisms in which one benefits and the other derives neither benefit nor harm.

From the above definition of commensalism, it is clear to note that it only involves two organisms rather than non-living organisms, hence; commensalism involves only biotic factors

4 0
3 years ago
Other questions:
  • When do chromatids separate during mitosis?
    7·1 answer
  • ⊂Select all the correct answers.⊃
    11·2 answers
  • The number of individuals of a single species per unit area is known as
    13·2 answers
  • In order to fit within a cell, dna becomes more compact by
    7·1 answer
  • Describe the technique used to care for instrumentation and supplies that have been exposed to the inside of the intestinal trac
    11·1 answer
  • A mutation to an organism's DNA will always result in an adaptation.<br> A True<br> B false
    9·1 answer
  • Answer quickly please
    12·2 answers
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • If you have done odesseyware please help
    7·2 answers
  • is it okay to use the organs of the deceased person without the family's consent if this is the only way to save someone's life?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!