Answer:
Argon
Explanation:
The element that has a complete valence electron shell is argon (Ar) since it is a noble gas in the last group on the periodic table. destinymitchell966
Answer:
c. the high-energy phosphates stored in muscle cells
Explanation:
Phosphocreatine (PC) or creatine phosphate is a compound rich in energy. It has energy stored in it which can be used to phosphorylate ADP into ATP. The phosphocreatine is stored in muscle cells when muscles are not working. The produced ATP serves as an energy source for muscle contraction. The creatine produced during ATP production is phosphorylated again into PC using ATP when muscles are resting.
Automatically region nervous system
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
