1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aev [14]
3 years ago
6

Explain the relationship between genes, traits, and diseases like a sickle cell?

Biology
1 answer:
DedPeter [7]3 years ago
3 0

Answer:

People with sickle cell trait carry only one copy of the altered hemoglobin gene and rarely have any clinical symptoms related to the disease. In contrast, people with sickle cell disease carry two copies of the altered hemoglobin gene.

Explanation:

You might be interested in
Plzz help me to do this please ​
Oxana [17]

Answer:

idek

Explanation:

7 0
2 years ago
Here is an important list of "nevers" to follow when using a compound light microscope in the lab. 1. Never swing the microscope
ivolga24 [154]

Answer:

D. "always" cover the microscope when not in use.

Explanation:

when you are finished using a light microscope or any microscope in general you always need to put the cover back on it. Mostly, to protect it from any harmful bacteria, light etc. and to keep it clean and, from collecting dust.

7 0
3 years ago
How do corals get food?
irina [24]

Answer:

Zooxanthellae only

Explanation:

Zooxanthellae is a colloquial term for single-celled dinoflagellates that are able to live in symbiosis with diverse marine invertebrates including demosponges, corals, jellyfish, and nudibranchs.

3 0
2 years ago
If a glacier melts back, would the change In albedo tend to cause temperatures to rise or to fall??? Someone answer I need help
garri49 [273]
It would tend to rise
4 0
3 years ago
A person who believes that genetics, chemical imbalances in the brain, and hormonal imbalances are responsible for explaining be
zhannawk [14.2K]

Hello there

the answer is

Nature

thank you

Best Regards Queen Z

8 0
3 years ago
Read 2 more answers
Other questions:
  • What is a dark area on the surface of the sun that is cooler than the surrounding areas
    8·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • In a 10 m2 ecosystem, there are 40 possums. What is the population density of possums? 2 per m2 4 per m2 10 per m2 40 per m2
    7·2 answers
  • Organisms closely related have less DNA in common?
    9·2 answers
  • The traits for blood type and Rh are the result of the presence or absence of particular (PROTEINS) or (ENZYMES) on the erythroc
    12·1 answer
  • which conversion is the function of a photovoltaic cell? A) sunlight to electricity B) sunlight to mechanical energy C) sunlight
    11·1 answer
  • What type of genetic testing is most sensitive for detecting any mutation in a specific gene
    10·2 answers
  • What is the BEST indicator of when a child is old enough to safely use a seat belt in a car?
    6·1 answer
  • All of the following are primary tissue types except
    6·2 answers
  • What is the function of the Earth's atmosphere?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!