1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mart [117]
3 years ago
14

Help me please omggggg ahhhhhh

Biology
2 answers:
Natasha2012 [34]3 years ago
4 0

Answer:

a

Explanation:

d1i1m1o1n [39]3 years ago
4 0

Answer:

Your answer should be B :) because the cat inherited his spots

Sorry of I am wrong!

You might be interested in
Which parts of an ecosystem perform cellular respiration? Which one is the right one : producers , primary consumers, secondary
Oduvanchick [21]

Answer: cellular respiration happens in the mitochondria and cytoplasm of cells.

Explanation: many organisms, including plants and plankton, per- form oxygen-dependent cellular respiration.

7 0
3 years ago
I need help on this plz
sveticcg [70]
The answer is B i did this before hope this helps
6 0
3 years ago
Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
erica [24]

Melting temperature of RNA duplex will be higher

Explanation:

  • RNA is a double stranded RNA with two complementary sequences
  • Duplex DNA is simply double stranded DNA
  • It is known A=U base pairs of duplex RNA is less stable than that of A=T base pairs of duplex DNA
  • RNA duplexes are considered to be more stable than DNA duplexes of comparable sequences but physical basis for thermal stability is not much known hence melting temperature of RNA duplex will be higher
5 0
3 years ago
7.
liraira [26]

Answer:

Explanation:

 

3 0
3 years ago
Read 2 more answers
What are two ways in which the body loses water?
Mice21 [21]

Answer:

sweating and urination

7 0
3 years ago
Other questions:
  • How are a person and a wax model of that person alike?
    13·2 answers
  • Which statement best explains why invertebrates often have outer skeletons but vertebrates do not?
    9·3 answers
  • How do animals get the nitrogen they need
    5·1 answer
  • What type of nutrition is shown in fungus
    7·1 answer
  • A plant-cell organelle
    7·1 answer
  • What is the difference between haploid and diploid??
    15·1 answer
  • Eyy necesito esto para un trabajo
    8·1 answer
  • #3.) Which of the following is true about the carbon cycle?
    12·1 answer
  • You are a geneticist working at a veterinary hospital. Your job is to help people understand genetic disorders that could affect
    13·1 answer
  • Explain why it is not possible to make a conclusion from<br> this experiment.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!