1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ASHA 777 [7]
3 years ago
13

Which function of the integumentary system is illustrated in the release of sweat? A. Absorption B. Protection C. Sensory Recept

ion D. Regulation E. Secretion F. Both regulation and secretion
Biology
1 answer:
ladessa [460]3 years ago
6 0

Answer:

F. Both regulation and secretion

Explanation:

Through sweat glands and superficial blood vessels, the skin is able to cool the body and regulate its internal temperature.

The eccrine sweat gland, which is controlled by the sympathetic nervous system, regulates body temperature. When internal temperature rises, the eccrine glands secrete water to the skin surface, where heat is removed by evaporation.

You might be interested in
Is the internal defense system the same as the immune system?
Maurinko [17]
The answer to this is yes the immune system is like the military of the body 
3 0
3 years ago
Read 2 more answers
Match the items.
vaieri [72.5K]

Answer:

d

Explanation:

because grass is the growth in the ground

8 0
3 years ago
if the generation time is 90min and the initial population is 10^3, how many bacteria growth will you get after 8hrs​
Verizon [17]

Answer:

5333

Explanation: if 1000 bacteria need 90 minutes for their growth then in 8 hrs the population of bacteria reach upto 5333.

5 0
3 years ago
What do you think will happen to the planet if plants are drastically reduced in population or become extinct?
Inessa [10]

Answer:

If all the plants on earth died, so would the people. ... When green plants make food, they give off oxygen. This is a gas that all animals must breathe in order to stay alive. Without plants, animals would have no oxygen to breathe and would die.

3 0
3 years ago
.True or False: Most mutations are neutral; they have little or no effect.
Nonamiya [84]
The majority of mutations have neither negative nor positive effects on the organism in which they occur.
8 0
3 years ago
Read 2 more answers
Other questions:
  • Describe how matter is transferred during photosynthesis and cellular respiration
    7·2 answers
  • Plants have chloroplasts in their cells that give them a green color. What is the function of the chloroplasts in plants?
    10·2 answers
  • Hummingbirds are pollinators.
    13·2 answers
  • Which event would most likely cause a change in
    10·1 answer
  • Cell structure and transport study guide
    14·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Help please I’m gonna cry
    7·2 answers
  • The transformation and transport of substances though parts of Earth's system are known as biogeochemical cycles. What elements
    15·2 answers
  • What organisms break down chemical wastes
    5·2 answers
  • Which is the best explanation for how earthquakes cause tsunamis?.
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!