1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Crazy boy [7]
3 years ago
15

Omg i need the answer lol

Biology
1 answer:
galina1969 [7]3 years ago
6 0

Answer:

Force is a measure of power. Velocity, on the other hand, is a quality an object has. Apply force to an object, and its velocity changes.

You might be interested in
Which of these is the thinnest? A.plate B.lithosphere C.oceanic crust D.continental crust
LuckyWell [14K]
It is definitely d for sure
7 0
3 years ago
Read 2 more answers
Which process is driven by the energy from earth’s interior?
tensa zangetsu [6.8K]

Answer:

solar energy

Explanation:

Solar energy mainly drives the processes that happen at the earth's surface, like the water cycle, wind, weathering, erosion, and growth. Energy from inside the earth is responsible for internal processes like volcanism, metamorphism, and plate tectonics.

6 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
What do you think is useful about knowing how to read a pedigree
Jobisdone [24]

Answer:

Knowing how to read a pedigree allows you to track through the family history and how a condition is passed down, if it is genetic. It allows you to tell if the condition is sex-linked, autosomal, dominant, or recessive. It also allows you to see the family and what occurs in the family, such as marriages, miscarriages, and other relationships.

5 0
3 years ago
What part of a cell keeps it in intact?
jekas [21]

Answer:

cell membrane

Explanation:

The cell membrane allows the cell to stay structurally intact in its water-based environment.

3 0
3 years ago
Other questions:
  • The first man sent into space was: Yuri Gagarin Edwin "Buzz" Aldrin Neil Armstrong
    12·1 answer
  • What is another word for volcanic? A. igneous B. plutonic C. extrusive D. crystallized
    12·2 answers
  • Tunnels formed by new bone deposition are lined by
    6·1 answer
  • A staphylococcus species is found to grow best at 30oc. which temperature group best describes this species?
    5·1 answer
  • Please help match!! :)
    15·1 answer
  • Which aspect of a chemical reaction is affected by enzymes?
    7·1 answer
  • Which chromosomal abnormality results from missing an entire chromosome?
    12·2 answers
  • Complete the following sentences to describe the stages of the lytic cycle of viruses. Then, place the stages in chronological o
    12·1 answer
  • 1) Explain why increasing the amounts of the two enzymes changed the life spans of the mice.
    8·2 answers
  • ? Help please would appreciate it
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!