1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
son4ous [18]
3 years ago
9

in fruit flies (drosphilia), one eye color Gene is x-linked, with a recessive white allele and a dominant red allele. if white e

ye female flies were bred to red eyed male Flies, what would be the expected Offspring (assume all parent toll flies are purebred)
Biology
2 answers:
Gnesinka [82]3 years ago
6 0

4 heterozygous offspring.the offspring will have red eyes but with the  recessive white eye trait.

Zina [86]3 years ago
5 0

Answer:

XR          Y

Xr XRXr XrY

Explanation:

Hello!

r: recessive white allele

R: dominant red allele

XX: female

XY: male

XrXr: white-eyed female. A possible gamete Xr  (

assuming a homozygous female)

XRY: red-eyed male. Possible XR and Y alleles.

50% of the offspring will be heterozygous female with red-eye phenotype (dominant)

50% of the offspring will be male with white eyes phenotype (recessive).

Successes with your homework!

You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
Which one is it I am confused A,B,C or D
dmitriy555 [2]

Answer:

I think option B is right answer

4 0
3 years ago
Read 2 more answers
What is the ultimate source of heat in the process of global warming
nalin [4]
The sun. Greenhouse gases absorb heat better. So the more of these gases, the hotter it gets. However, the earth itself is naturally heating, but it goes too fast for live to adjust to the temperatures.
3 0
4 years ago
What conversion factor is needed to change from kilometers to meters
Vesna [10]

。☆✼★ ━━━━━━━━━━━━━━  ☾  

To convert from kilometers to meters, you would multiply by 1000

So, the conversion factor would be x 1000

This can also be written as x 10^3

Have A Nice Day ❤    

Stay Brainly! ヅ    

- Ally ✧    

。☆✼★ ━━━━━━━━━━━━━━  ☾

4 0
3 years ago
A relationship I. Which one species cosumes
dimulka [17.4K]
I am going to assume it mean what i think it does and say <span>A) Predation</span>
7 0
3 years ago
Other questions:
  • Kohlberg asked subjects to explain how they would respond to moral dilemmas true or false
    8·1 answer
  • Coral reefs are unaffected by pollution.<br> true or false
    13·1 answer
  • Bone contains living cells and organic matter such as collagen, protein, and polysaccharides. However, much of the volume of bon
    7·1 answer
  • 11. Which of the following statements is/are correct?
    13·2 answers
  • A very acidic ph level is ______ , and very basic ph level is
    9·1 answer
  • How does the random motion of molecules relate to diffusion/osmosis?
    13·1 answer
  • Choose all the answers that apply.
    12·2 answers
  • Nyatakan empat contoh kegunaan air sebagai pelarut semesta dalam domestik dan industri pembuatan​
    15·1 answer
  • Please help I need it ASAP!!
    6·2 answers
  • Do you think people can misdiagnose themselves with the flu?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!