Answer:
Option D
Explanation:
Cyanobacteria preserve its photosynthetic pigments in the thylakoids which allows masking of green of chlorophyll a and other accessory pigment i.e phycobiliproteins (phycocyanin, allophycocyanin and phycoerythrin).
Chlorophyll a is mainly responsible for harvesting light for photosynthesis. Phycocyanin is blue in color, allophycocyanin is blue in color and phycoerythrine is red in color. These together harvest light in the green, yellow and orange part of the spectrum which cannot be used by other phytoplankton species
Hence, option D is correct
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
People went to mars out of pure curiosity looking for aliens and other beings in the universe and now that is the same reason people want to go to mars and they would like to see if they could actually live on mars as a colony.
<span>Lithification is the process by which sediment turns into hardened rock. There are three ways in which lithification can occur. These processes are called compaction, recrystallization and cementation
so sediments (sand) are buried the increase in pressure from the weight of the overlaying material pushes the grains closer together. the volume of sediment is reduced and the fluids between the grains are also squeezed out. this leaves the sandstone tightly compressed together this is lithification.
</span>
