1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Veseljchak [2.6K]
3 years ago
8

What does the Coriolis effect directly impact?

Biology
2 answers:
frosja888 [35]3 years ago
8 0
The Coriolis effect impacts the wind pattern around the globe.
Ann [662]3 years ago
3 0
Outside storm systems, the impact of the Coriolis effect helps define regular wind patterns around the globe. As warm air rises near the Equator, for instance, it flows toward the poles. In the Northern Hemisphere, these warm air currents are deflected to the right (east) as they move northward.
Hope this helps
You might be interested in
Which characteristic involves cleavage and fracture?
Anarel [89]

The Answer Is A. Hope This Helps ;P

6 0
4 years ago
Read 2 more answers
Octopus and squid have chemoreceptors on their​
lubasha [3.4K]

Answer:

tentacles

Explanation:

hope this helps :]

8 0
3 years ago
Read 2 more answers
Why arent descriptive investigation repeatable
trapecia [35]

n descriptive investigations, we still haven't formed any hypothesis yet so we seek information by asking question.


It's net repeatable because repeating the questions over and over again without any clue about what we want to seek is completely waste of time




8 0
3 years ago
Which of the following statements is not true about mRNA?
ASHA 777 [7]

Answer:

The correct answer is d. eukaryotes almost always produce polycistronic mRNA

Explanation:

mRNA can be polycistronic or monocistronic. A monocistronic mRNA contains the information of one gene only so a monocistronic mRNA code only one protein at a time but a polycistronic mRNA can code for multiple proteins at a time.

In eukaryotes, one transcriptional unit carries the information of only one protein so eukaryotes produce monocistronic mRNA but some eukaryotes are capable of having polycistronic mRNA.

In prokaryotes, many genes are transcribed as a unit to produce multiple proteins so prokaryotes produce polycistronic mRNA. Therefore the statement which is not true is d. eukaryotes almost always produce polycistronic mRNA.

3 0
4 years ago
The number of organisms in a food pyramid decrease as the trophic level
Monica [59]
Normally, the number of organisms in a food pyramid decreases as the trophic level increases. But in some cases, the pyramid may be inverted, for instance, when the productor is a single tree, and beetles eats its leaves, and birds eat the beetles. There is the biomass pyramid too, that represents the amount of mass present in the organisms of the food chain.

5 0
3 years ago
Read 2 more answers
Other questions:
  • Predict the results from the following crosses: Rr x rr.
    14·1 answer
  • What are the changes in the genetic code called that can occur during dna replication?
    9·1 answer
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • What are two ways that prokaryotes provide nutrients to humans
    7·1 answer
  • What is electricity
    11·1 answer
  • How to isolate Saccharomyces cerevisiae (Baker’s yeast)?
    9·1 answer
  • If athletes “pasta load,” they consume a lot of what?
    14·2 answers
  • Help me pls!!!! ASAP
    10·1 answer
  • Convertir 6,79 kg a dg
    11·1 answer
  • Reproductive cells go through
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!