I’m stage 2 of photosynthesis NADP becomes NADPH why?

1 answer:

6 0

NADPH is a reduced form of NADP+. The latter features an extra hydrogen ion in its chemical structure. When NADP+ transforms into NADPH, the other hydrogen ion is released as part of the reaction while the other hydrogen ion becomes a part of the NADPH structure.

You might be interested in

HELP HELP PLEASE!!!!!!!

postnew [5]

Explanation:

Issen Sengeki... Messatsu!

The answer is 2.

"Weakness is a disease... I am the cure! When I walk, I walk alone. When I fight, I fight alone. The path of a weak coward is into the bowels of hell! Death is the only destination for life. Better die a free brave man."

- Akuma

3 0

2 years ago

(blank) measures how much space matter takes up.

irga5000 [103]

Answer:

volume

Explanation:

it's volume I think

8 0

2 years ago

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0

2 years ago

What is special about enzymes shape

umka21 [38]

Answer:

Hope this helps some!!

Explanation:

The shape of an enzyme is very important because it has a direct effect on how it catalyzes a reaction.
An enzyme's shape is determined by the sequence of amino acids in its structure, and the bonds which form between the atoms of those molecules.

3 0

3 years ago

How does genetic variability allow these lizard populations to survive ?

Maslowich

It allows the individual in a populations to survive and have offspring with the desire trait needed to live while those without will die out

5 0

2 years ago