1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Goshia [24]
3 years ago
6

Which is not an immune system disorder - Allergies - Asthma - Fungi - HIV/AIDS

Biology
2 answers:
guapka [62]3 years ago
6 0

Answer:

Fungi

Explanation:

Aleonysh [2.5K]3 years ago
3 0

Answer: Asthma

Explanation: Asthma is Shortness of breath, wheezing, and cough are symptoms of a LUNG ILLNESS characterized by constriction of the airways, the tubes that convey air into the lungs, which are irritated and restricted.

You might be interested in
In the 19th century, childbed fever* was
Maslowich

Answer:

No

Explanation:

I can't give the numbers because I don't have the source

6 0
3 years ago
What does blood bring to cells
noname [10]

Answer:

supplying oxygen to cells and tissues. providing essential nutrients to cells, such as amino acids, fatty acids, and glucose.

Explanation:

it jus makes sure that we get oxygen to our cells and tissues so we dont die.

4 0
3 years ago
Read 2 more answers
A gene on a chromosome lies close to another gene controlling a different trait. This indicates that the genes are _. The first
umka2103 [35]

My guess:

I do not know the options to the blanks, but I'd say that the answer to the first one is "strongly linked". Think of a chromosome as a phylogenic chart → 2 species that are beside each other are strongly linked, if compared to 2 species 3 spots apart form each other. So, 2 genes that are close to each other are strongly linked.

I do not know the options to the blanks, but I'd say the answer to the second one is epistasis → which is the interaction between two different genes (different means they're not linked alleles).

Hope it helped,

BioTeacher101

7 0
4 years ago
Read 2 more answers
How are viruses and bacteria different?
Ivahew [28]

Viruses go around in the air and bacteria you have to touch

8 0
3 years ago
Read 2 more answers
Based on the diagram, which three consumers all get their energy from the same producer?
LiRa [457]

Answer:

The squirrel, robin, and field mouse

Explanation:

A producer is what gets its energy directly from the sun (usually a plant) and the squirrel, robin, and field mouse all eat the plant seeds, which get energy from the sun .

5 0
3 years ago
Other questions:
  • How many generations has it been since chimpanzees split from humans?
    11·1 answer
  • How is the equation for photosynthesis different from cellular respiration?
    10·1 answer
  • Someone knows the answer and can help me
    14·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • ____. is the most important factor in soil formation. rainfall wind animal life plant life
    12·2 answers
  • After letting his soil sample sit in water for an hour, Mark concludes that just one type of material made up the soil. Jack con
    10·2 answers
  • HELPPPPP PLEASEEEE ITS DUE IN LESS THAN 20 MINUTES PLEASEEE!!
    14·1 answer
  • What is photorespiration? Why is it bad and why does it occur?
    9·1 answer
  • Draw the DNA strand separating down the middle is in the beginning of DNA replication
    6·1 answer
  • HELP ! 50 POINTS !!
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!