1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mariarad [96]
3 years ago
8

Which two phrases describe the nature of the gravitational force?

Biology
1 answer:
iris [78.8K]3 years ago
6 0

Answer:

a force that pulls objects toward each other

You might be interested in
Which situations would be most likely to engage the anterior cingulate cortex?
maria [59]

Answer:

Which of the following situations would be most likely to engage the anterior cingulate cortex?

A waiter walks over to your table at a restaurant and holds an open menu in front of you.

You walk into the elevator of your apartment building and press the button for your floor.

You enter your classroom and find someone sitting in your usual seat.

A good friend asks you to remind him of your telephone number.

Explanation:

In order to meet the demand of the surrounding environment   by adjusting  the  motor outputs from the brain to the environments ,a part of the emotion control part of the brain( limbic system) called the anterior cingulate cortex is responsible for this.

Anatomically, the limbic system is made up of the primarily the amygdala, hippocampus, thalamus, hypothalamus, basal ganglia and cingulate gyrus.

Based on the this its(anterior cingulate cortex) functions are formation of emotion in the limbic system, and  possessing  of memory and learning.

it is also a major  parts of  of pain networks for pain modulation and perception.

Therefore whenever there is  change in the environment  from the prestored condition in the brain,(e.g the usual seat  in the class room  occupied above) the anterior cingulate cortex adjust the motor input from the brain to adapt to the new environment to take an action,whih in this case  leads to the reclaiming of the seat or any other necessary proactive action.

4 0
3 years ago
Star A has a surface temperature of 8000K and its thermal emission peaks around 360nm. Star B is twice as cold, with a temperatu
vladimir2022 [97]

Answer:

180 hope this helps tell me if its wrong

Explanation:

4 0
3 years ago
I need help in class, I have one more to finish! Pls, help me, guys!
Ludmilka [50]

Answer:

If its dna replication: TTCATGCTATGCTACGTGTACGTACCGAT

If its transcription: UUCAYGCYAYGCYACGYGYACGYACCGAU

Explanation:

8 0
3 years ago
Many g protein-coupled receptors contain seven transmembrane α-helical domains. the amino end of the protein lies at the exterio
olga55 [171]
<span><span>The carboxyl end of the G- protein-coupled receptor (GPCR) is located in the cytosol (it is intracellular). Carboxyl terminus is one of the most variable structures of the protein. All of the GPCR  are </span><span>structural and functional similar, unlike their ligands.</span></span>
6 0
3 years ago
Answer True or flase
Alekssandra [29.7K]

Answer:

4. False

5. False

Explanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • Athletes with mono are typically held out of all physical activity for a period of _____ after diagnosis.
    7·1 answer
  • When an economy is experiencing higher real interest rates, business firms will most likely be discouraged from investing in:
    6·1 answer
  • What is the definition of the periodic table
    15·1 answer
  • What is the hydrogen ion (H+) concentration of a solution of ph 8?
    15·2 answers
  • Why are geese migrating to meet their basic needs
    5·2 answers
  • Destruction of tropical rain forests
    12·2 answers
  • NEED ANSWER ASAP<br> QUESTION BELOW!
    13·1 answer
  • Cofactors for some enzymes are not considered prosthetic groups because they are loosely held during the course of reaction.A. T
    6·1 answer
  • GIVING BRAINLIEST <br> How does a large mass star undergo a supernova?
    15·1 answer
  • Fluid tends to be forced out of a capillary bed by ________ while ________ tends to draw fluid into the capillary bed. *
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!