1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mama L [17]
3 years ago
7

Identify the model that best represents the plasma membrane of a hypothetical cell that exists in a nonaqueous environment and w

hose eytosol is similar to that of an animal cell. Provide TWO pieces of reasoning to support your identification.
Biology
1 answer:
Klio2033 [76]3 years ago
8 0

Answer:

The models are missing in the question. The models along with the question is provided in the attachment below.

The answer is : Model A represents the Plasma membrane.

Explanation:

According to the question, model A represents the plasma membrane. The reasons are :

(a). In the model A, the bilayers consists of two leaflets of the amphipathic lipid molecules. Here the polar head groups is in contact with the intra cellular or the extra cellular non aqueous phase, where the non polar tails are facing each other constituting the hydrophobic interior of the membrane.

(b). Lipid are not rigid as well as static structure. In the lipid bilayer, the lipid molecule are able to rotate around their axis freely and diffuse laterally with each leaflet.

(c). The plasma membrane acts as the selective plasma membrane.

You might be interested in
The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
olchik [2.2K]

Answer:

According to the  number of sequence on DNA  there should be 10 amino acid. But after 7 amino acid there is stop codon so only 7 amino acid can be synthesized.

Explanation:

DNA sequence given here is CCTACCTTATGCCAAGTTGGGGATAAACTC it is read from left to right. When this DNA is transcribed mRNA sequence will be-

GGAUGGAAUACGGUUCAACCCCUAUUUGAG. These 30 nucleotide will synthesize following amino acids-

GAG  UUU  AUC  CCC  AAC  UUG  GCA  UAA  GGU  AGG-

Glutamine,  Phenylalanine,  Isoleusine,  Proline, Asparagine ,   Leucine,  Alanine,   stop codon.  As ribosome reach on stop codon protein synthesis stopped and process aborted.

8 0
3 years ago
How is DNA fragment length measured?
jonny [76]

Answer: Its measured with the use of gel electrophoresis.

Explanation: Scientists use a method known as gel electrophoresis to measure the lengths of DNA fragments. Electrophoresis works because fragments carry a small charge.

3 0
3 years ago
Read 2 more answers
An adult client with mobility problems wishes to become an organ donor. Which act allows the client to donate his or her organs?
jeyben [28]

What are the answer choices?

5 0
3 years ago
Erosion is a destructive force that
photoshop1234 [79]
I would say that this would be 2. Breaks down existing landforms to create new ones
5 0
3 years ago
Read 2 more answers
Which describes the correct order of the geologic time scale, from oldest to most recent?
Sedbober [7]
The correct answer is D. Precambrian Time - Paleozoic Era - Mesozoic Era - Cenozoic Era. This is the correct order of the geologic time scale, from oldest to most recent. Thank you for posting your question. I hope this answer helped you. Let me know if you need more help. 
3 0
3 years ago
Read 2 more answers
Other questions:
  • What system is affected if large number of T cells were attacked by a virus
    5·1 answer
  • Describe asexual and sexual reproduction as survival strategies
    12·1 answer
  • Buatlah kunci determinasi dari tumbuhan manga, jati,cemara,pepaya,padi dan pinang!
    14·1 answer
  • Evolution acts on _____ over time​
    9·1 answer
  • 6. The height of tides changes throughout the day mainly because
    11·1 answer
  • Explain how the production of eukaryote mRNA is like watching a tv show that is on Netflix.
    12·1 answer
  • What is the function for chromatin?
    15·1 answer
  • What is missing from the venn diagram PLEASE HELP!!
    11·1 answer
  • Which statement is true about human population today?
    8·1 answer
  • Use what you have learned about the types of energy that travel from the sun to earth to match each term with is description
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!