1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ilia_Sergeevich [38]
2 years ago
13

A survey of Gigi’s customers showed that 1,550 out of 1,700 of the customers buying tomatoes would buy organic tomatoes if the t

omatoes were placed in crates. In the first month, 950 of those 1,700 customers actually bought the organic tomatoes. What was the percent error in the survey estimate of the number of people buying organic tomatoes? Round the answer to the nearest tenth.
35.3%
55.9%
61.2%
63.2%
Mathematics
2 answers:
Natalka [10]2 years ago
5 0
Hi I think it is 63.2
PolarNik [594]2 years ago
5 0

Answer:

63.2%

Step-by-step explanation:

You might be interested in
!!!50 POINTS!!! Help Please 2. Which functions are exponential decay functions? Choose exactly two answers that are correct. A.
Goshia [24]
A characteristics of an exponential decay function is it has a constant term that is lesser than 1, this is because when you raise it a number that is lesser than 1 to higher values the result will be lesser and lesser, that is why it is called decay function. so the decay functions are a. f(x)=0.9^x and d. <span>j(x)=(4/5)^x</span>
5 0
3 years ago
How to solve 5 x to the 4th power
hammer [34]
Do 5x5x5x5 which is 625
5 0
3 years ago
The formula for finding the length of an arc on a circle is L=277 (1360), where r is the radius of the circle and x is the measu
kari74 [83]

Answer:

I don't know the answer I'm sorry.

8 0
3 years ago
Add the following using the common denominator method. Show all of your work. <br><br> 2/3 + 2/9
Alekssandra [29.7K]

Answer:

8/9

Step-by-step explanation:

First we need to get both of the fractions to the same denominator.

1. 2/3 + 2/9 = 6/9 + 2/9

Next, we simply just add the fractions.

2. 6/9 + 2/9 = 8/9

8 0
3 years ago
Find the area of the triangle
Archy [21]

Step-by-step explanation:

total base length has to be found.

(√(3.6)^2+(3.25)^2+6.2)*3.25*.5=3.97

6 0
2 years ago
Other questions:
  • What transformations change the graph of f(x) to the graph of g(x)? f(x) = 3x2 g(x) = 9x2 - 4
    7·2 answers
  • The graph shows the system equations that can be used to solve x^3+x^2=x-1
    7·2 answers
  • What’s 16/24 as an equivalent fraction
    11·2 answers
  • Evan is thinking of a 3-digit odd number that uses digit 7 twice. The digit in the tens place is less than 1. What is the number
    6·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Solve for X 3 (x+1)=9
    11·1 answer
  • The perimeter of a rectangle is 304 cm. The length is 40 cm longer than the
    11·1 answer
  • You start at (-4, 4). You move down 1 unit and left 1 unit. Where do you end?
    11·1 answer
  • Bernie helped design a magician costume for a school play
    14·1 answer
  • Y=-3^x what is the answer
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!