1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
slava [35]
3 years ago
14

True/False: Disruptions to an ecosystem can be naturally occurring OR due

Biology
1 answer:
Serjik [45]3 years ago
6 0
True examples of human disruption could be us cutting down trees in forests (deforestation) for wood or use in other things
You might be interested in
Which of the following
Nikitich [7]
I think A Import Crops
4 0
3 years ago
Read 2 more answers
According to Dutch scientist Christiaan Huygens, what was light made of
love history [14]
Sir Isaac Newton, held the theory that light<span> was </span>made<span> up of tiny particles. In 1678, </span>Dutch<span> physicist, </span>Christiaan Huygens<span>, believed that </span>light<span> was </span>made<span> up of waves vibrating up and down perpendicular to the direction of the </span>light<span> travels, and therefore formulated a way of visualizing wave propagation.</span>
5 0
3 years ago
Read 2 more answers
Transcription occurs in the _______, while translation occurs in the _______.
Vikki [24]

Answer:

Explanation:

In a eukaryotic cell, almost all transcription occurs in the nucleus and translation occurs mainly at ribosomes in the cytoplasm. In addition, before the primary transcript can leave the nucleus it is modified in various ways during RNA processing before the finished mRNA is exported to the cytoplasm.

8 0
3 years ago
Lesson 11 part 1 introduction analyzing text structures
LenaWriter [7]

Answer:

add the questions

Explanation:

add the questions without an image Ill answer

5 0
3 years ago
Read 2 more answers
17. Which of the following is an acid?
jeka94

Explanation:

c is an acid I think but it may not be right

3 0
3 years ago
Read 2 more answers
Other questions:
  • While you are speaking with a client diagnosed with gout, she states that she has no symptoms of the disease and asks you to exp
    10·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Scientists have genetically engineered crops such as corn, cotton, and soybeans. Which of the following statements about genetic
    11·2 answers
  • Which is a function common to both the muscular and skeletal systems? breaking down of food bending of the arm production of blo
    8·2 answers
  • Why are concentration gradients important to cells
    9·1 answer
  • I really need this ASAP! Thank you!
    10·2 answers
  • A farmer’s profit is determined by the amount by which the sale value of the ___ ___ exceeds the cost of production and distribu
    12·1 answer
  • Item 3 Generally, in which direction does wind blow? horizontally vertically only from west to east only from east to west
    11·2 answers
  • Which of the following is responsible for getting complex molecules across the cell membrane?
    7·1 answer
  • Starting with the cells, describe what would happen in the respiratory system as the adrenaline is increased.
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!