Answer:
Body moving from one place to another in a vertical plane. Develop bodily control. Walking, running, leaping, jumping, hopping, galloping, sliding, & skipping.
Explanation:
Answer:
No, bottled water cannot go bad.
Explanation:
It is impossible for any sort of water to "expire". But, when in the bottle for to long, the plastic does become dangerous. The bottle begins to leak chemicals into the water. This doesn't make the water toxic, but it can alter the taste of your water.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
the answer is A. E. coli B
Explanation:
The multiplicity of infection (MOI) refers to the ratio between the numbers of viruses used to infect <em>E. coli</em> cells and the numbers of these <em>E. coli </em>cells. Benzer carried out several experiments in order to define the gene in regard to function. Benzer observed that <em>E. coli </em>strains with point mutations could be classified into two (2) complementary classes regarding coinfection using the restrictive strain as the host. With regard to his experiments, Benzer observed that rII1 and rII2 mutants (rapid lysis mutants) are complementary when they produce progeny after coinfect E. coli K (where neither mutant can lyse the host by itself). The rII group of mutants studied by Benzer does not produce plaques on <em>E. coli</em> K strains that carry phage λ (lysogenic for λ), but they produce plaques on <em>E. coli</em> B strains. This study showed that rIIA and rIIB are different genes and/or cistrons in the rII region.