1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Julli [10]
3 years ago
10

Help!! with any, ASAP

Mathematics
1 answer:
il63 [147K]3 years ago
6 0
1.
409,509,609

Add 100
You might be interested in
Brianna is playing a video game and loses 3.5 lives. Later she gains 6 more lives. What is the overall change in Brianna's total
fredd [130]
It depends how much she begins with but if she doesn’t begin with any then it’d be 2.5
5 0
3 years ago
Read 2 more answers
I am not irrational, I am an integer, I am a natural number, and I am a prime number. What number am I?
LuckyWell [14K]

Answer:

I think 1

Step-by-step explanation:

8 0
3 years ago
Read 2 more answers
What did the term 4x have in common (have the same) with x,120x, -3x?
Lera25 [3.4K]

Answer:

They're all like terms (x)

7 0
3 years ago
Read 2 more answers
An unknown number is increased by -3. the result is -8<br> find the unknown number
Rudiy27

Answer:

The unknown number is -5.

Step-by-step explanation:

-3 + -5 = -8

-8 - -3 = -5

-8 - -5 = -3

6 0
2 years ago
I don’t know how to do this math problem
Svetach [21]

Answer:

I'll help

Step-by-step explanation:

No worries man

3 0
3 years ago
Read 2 more answers
Other questions:
  • Which cylinder has a volume of 457 cm?
    13·1 answer
  • You borrow $18,000 to buy a new car. You will pay $3,240 in simple interest at the end of 6 years. What is the annual interest r
    5·1 answer
  • Please help me out! :)
    11·1 answer
  • Find the slope of the line passing through the points<br> (-4,-3) and (8,-9)
    6·1 answer
  • A certain company's main source of income is selling socks. The company's annual profit (in millions of dollars) as a function o
    13·2 answers
  • How to solve 1542-517=
    15·2 answers
  • A common inhabitant of human intestines is the bacterium Escherichia coli, named after the German pediatrician Theodor Escherich
    8·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Evaluate A/B for a = 1/2 and b = -3/7
    14·2 answers
  • Find x A. 212√2 B. 212–√ C. 213√2 D. 7
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!