1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aalyn [17]
3 years ago
5

What is the primary function of the nervous system in keeping the body in homeostasis?

Biology
1 answer:
Fed [463]3 years ago
7 0
The autonomic nervous system<span> plays an essential </span>role<span> in </span>keeping the body'sinternal environment (temperature, salt concentration, blood sugar, oxygen and carbon dioxide level in blood, etc) in proper balance, a condition calledhomeostasis<span>. ... These and other </span>body<span> actions are controlled by the autonomic</span>nervous system<span>.


Hope this helps :)</span>
You might be interested in
In cases of shingles, the antiviral drug _______ may be prescribed.
vladimir2022 [97]

Answer:

In cases of shingles, the antiviral drug Zovirax (acyclovir), Valtrex (valacyclovir), or Famvir (famciclovr) may be prescribed.

Explanation:

8 0
3 years ago
Quiet metabolic activities account for about ________ of the average person’s daily energy expenditures
Valentin [98]

Quiet metabolism account for about 50% of the average person’s daily energy expenditures

A metabolism is a balancing act that involves two types of simultaneous activities: building up body tissues and energy stores (called anabolism) and breaking down body tissues and energy stores to get additional fuel for body functions (called catabolism)

Some of them are catabolic routes, such as glycolysis (the breaking of glucose), -oxidation (the breakdown of fatty acids), and amino acid catabolism. Others are anabolic pathways, such as those involved in energy storage (such as glycogenosis) and triglyceride synthesis (lipogenesis)

Metabolic pathways include the processes of producing and decomposing glucose molecules. A metabolic pathway is a chain of chemical reactions that feed off of one another.

To learn more about metabolism please visit -
brainly.com/question/19664757
#SPJ4

6 0
1 year ago
Which organism develops breathing organs from pharyngeal arches?
KATRIN_1 [288]
I think it’s C
Hope that helped
3 0
3 years ago
Translation or protien synthesis is a
Gnesinka [82]

Answer:

Multi-step process

Because it can be done twice or more

5 0
3 years ago
Explain what structure A in the picture above does during DNA Replication?
Aleks04 [339]

Answer:

Where is the picture?

Explanation:

6 0
3 years ago
Other questions:
  • A diagram that shows thermal energy being released by objects is called a ___________.
    5·2 answers
  • Which is a lymphocyte? A. Urethra B. B cell C. Amylase D. Macrophage
    10·1 answer
  • Some bacteria are decomposers, which fill an important role in the food web. What
    9·1 answer
  • Which type of relationship exists between the algae and fungi that form lichen
    6·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • We are all born as naturalists eager to explore the world through our senses.
    5·1 answer
  • What happens to the DNA helix when a cell reproduces?
    9·1 answer
  • A bumblebee helps plants reproduce by carrying pollen from a flower on one plant to a flower on another plant. Which reproductiv
    12·1 answer
  • The backbone of the cell to which all organelles are attached, also functions in cell division is ______?
    9·2 answers
  • What happens when an HIV infection occurs? ​
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!