1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Westkost [7]
3 years ago
8

* what’s a small cellular structure with a specific function

Biology
1 answer:
eduard3 years ago
7 0

Answer:

tissues

Explanation:

organised to perform one or more specific function

You might be interested in
2. Explain how the Coriolis effect affects wind flow.
meriva

Answer:

The Coriolis Effect contributes to the circular motion of the wind around pressure systems which move weather patterns in the southeastern United States. The Earth rotates at a high speed counter-clockwise as viewed from the North Pole. The Coriolis Effect does not impact the wind speed, only the wind direction.

Explanation:

5 0
3 years ago
Read 2 more answers
Pepsinogen, a digestive enzyme, is secreted by the ________.
solmaris [256]
Pepsinogen, a digestive enzyme ,is secreted by the  chief cells in the gastric mucosa.
8 0
4 years ago
Direct current is produced by
solniwko [45]
Direct current is produced by batteries, fuel cells, rectifiers, and generators with commutators
3 0
3 years ago
Read 2 more answers
Which zone revives the most sunlight
sineoko [7]

the equator .............

4 0
3 years ago
Read 2 more answers
What form of life was developing on Earth 4500 million years ago?
PtichkaEL [24]

Answer:

4600-4500 million years ago, the Earth formed and its crust cooled to become solid. 4500-4400 million years ago, the oldest known thing to have formed on Earth, zircon, formed along with solid crust and oceans. 4200-4100 million years ago, the close of the Hadean Period (there are no surviving rocks).

4 0
2 years ago
Other questions:
  • A reflexive reaction that is reliably elicited by an unconditioned stimulus is called a(n):
    8·1 answer
  • What are sudden large declines in biodiversity in the fossil record called?
    9·1 answer
  • ANSWER FOR BRAINLIEST
    10·1 answer
  • Some plants produce a _________________________ between the plasma membrane and the primary cell wall.
    5·1 answer
  • The freezing and thawing action of water affects a rock by?
    10·1 answer
  • Blue jays and robins do not interbreed. assuming that blue jays share the same habitat, describe the possible conditions that ke
    13·2 answers
  • Meiosis results in two cells that are identical to the original cell. is this statement true or false?
    6·2 answers
  • What organelle's function is to CARRY material to export out of the cell?
    8·1 answer
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • Why we are saying it as carbaminohemoglobin not carboxyhemoglobin???​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!