1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mekhanik [1.2K]
3 years ago
5

Given that polyurethane is a huge polymer (mw >>?????????,????????? daltons), why is it important that the polyurethanase

is a secreted enzyme? if we assume that the polyurethane is the source of energy for the "elvis meltdown!" by stewart, smith and shields page ??? organism, how can material (carbon atoms) from it fi nd its way into the central metabolic pathways of this microbe? what is the "entry point"? what happens after its entry into the metabolic pathway?
Biology
2 answers:
Viefleur [7K]3 years ago
5 0

Polyurethanase is an enzyme emitted by the microorganism so as to break polyurethane. Since the polymer is a significant wellspring of energy for the life form, it should be separated all together for etpum"s development.

Further details

Polyurethane

It is a polymer made out of organic units and carbamate links join them. While most polyurethanes are thermosetting polymers that don't liquefy when warmed, thermoplastic polyurethanes are likewise accessible. Polyurethanes are available in numerous parts of present-day life. They present a class of polymers that have discovered a far-reaching use in the medical and mechanical fields. Polyurethanes can be found in items such as furniture, coatings, cement, constructional materials, paints, elastomers, filaments and paddings. Polyurethane ought to be curtailed to PUR in consistence with authority German and International benchmarks.

Polyurethanase

It can be defined as such an enzyme which is secreted by microbes and used for the breakdown of polyurethane. In this breakdown process energy is released that is utilized by microorganisms.

Bio-degradation of Polyurethane

In spite of their microbial obstruction, polyurethane is attacked by microscopic organisms however the component to explain its bio-degradation is unknown. There are reports from microscopic organisms and parasites that are equipped for the breakdown of polyurethane yet the examinations about the proteins that assault the plastic are centered around bacterial compounds as it were. The enzyme is of sort esterase and protease for the most part since these chemicals are unspecific and can perceive a few regions in the polyurethane particle and hydrolyze it.

Answer details

Subject: Biology

Level: College

Keywords

  • Polyurethane
  • Polyurethanase
  • Bio-degradation of Polyurethane

Learn more to evaluate

brainly.com/question/10560288

brainly.com/question/12603071

vesna_86 [32]3 years ago
3 0

The reason that polyurethane is important as a secreted enzyme is that most exoenzymes roles are to break down lager macromolecules outside of the cell so they are able to enter the cell. Exoenzymes are therefore more effective as large molecules.

If polyurethane is an energy source, it would first be broken down by exoenzymes of the bacteria. Then it would be incorporated into the cell through facilitated diffusion. Due to its rich carbon, the energy source would enter the glycolysis pathway, then the Krebs cycle (for aerobic bacteria). The energy source would be used in the making of ATPs.






You might be interested in
Question 14 unsaved unlike endocrine glands, exocrine glands question 14 options: release hormones. release secretions directly
Ugo [173]
Exocrine glands release secretions outside of the body.

One way to remember this is:
exo = outside  
endo = inside

An example of an exocrine gland is a sweat gland. They release sweat (an excretion) to the outside of your body.

I hope this helps! I'm happy to answer any other questions you might have :)
5 0
3 years ago
Read 2 more answers
Which of the following shows the difference between aerobic and anaerobic respiration respiration?
Svetradugi [14.3K]
I think the correct answer is b sorry if wrong
3 0
2 years ago
Most of the energy used by organisms comes from the sun. Which sentence from the article provides the BEST support to the statem
Igoryamba

Answer:

The correct answer is B it is best support to the statement. Give me Brainiliest

3 0
2 years ago
Which substance is constantly processed by some excretory organs even though it is not excreted by the excretory system?
jolli1 [7]
Blood is constantly processed by some excretory organs even though it is not excreted by the excretory system.
5 0
3 years ago
Read 2 more answers
The tegu population in south Florida feels sort of a
TiliK225 [7]
Kjdjdbdbbsiisisnsnskskkdnsnw
5 0
3 years ago
Other questions:
  • What do the rib muscles and diaphragm have in common?Both aid in the expansion and relaxation of lungs.Both produce red blood ce
    10·1 answer
  • How do herbivores get energy
    11·2 answers
  • Which is a type of muscle tissue that is most often controlled by conscious thought?
    10·2 answers
  • Gigantic mammals (mammoths, giant sloths, etc.) characterize these times.
    12·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • A homeostatic imbalance that activates these bone cells would lead to a loss of bone density. True or False
    13·1 answer
  • What is the 10th book in the bible
    7·2 answers
  • An epistatic allele in labrador retrievers ensures that ee lab pups are yellow. Two other alleles control coat color, where blac
    10·1 answer
  • 4. Which unit of measurement do astronomers use when measuring the
    5·2 answers
  • The majority of neurotransmitters migrate across the synaptic gap and latch onto receptor sites of the receiving neuron's:
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!