1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Neporo4naja [7]
2 years ago
10

When crude oil is distilled, it is separated into categories. What are those categories characterized by?

Biology
1 answer:
goldfiish [28.3K]2 years ago
6 0

Answer:

Differences in their boiling points

Explanation:

When crude oil is distilled and separated into categories, the categories are characterized by the differences in their boiling points.

At different boiling points, each of the fraction will separate out.

  • Crude oil is made up of different fractions of hydrocarbons.
  • As the chain length of the hydrocarbon increases, the volatility reduces and boiling point increases.
  • Components with short carbon lengths rises out from the column first and are cooled and extracted.
  • The categories are thereby, classified based on differences in their boiling points.
You might be interested in
Which one of the following is a characteristic of a metal?
alex41 [277]
B) Most metals conduct heat readily. In pure elemental forms, they neither have basic or acidic properties. Other properties include malleability, high melting points, high densities, and electric conduction.
4 0
3 years ago
Read 2 more answers
What do I fill I. The labels?
Mila [183]
Fill out the labels that is what It says in tha page
4 0
3 years ago
Read 2 more answers
Breakup of a larger habitat area into smaller areas, usually as a result of human activities.​
oksano4ka [1.4K]

Answer:

uh yeah I think

Explanation:

4 0
3 years ago
How many valence electrons does each carbon atom have ?
ipn [44]
One carbon atom has 4 valence electrons. Hope this helps
4 0
2 years ago
Read 2 more answers
Which of the following is an example of technology we currently add to people's bodies? O A Computer brain OB Electronic lungs O
Pavlova-9 [17]

Answer:D. Prothetic leg

Explanation:

All the other answer choices are still dreamt of by many scientists and engineers. but you always see people wearing prosthetic legs. D is the obvious answer.

8 0
2 years ago
Other questions:
  • Infantile Tay-Sachs is a fatal disease caused by a recessive allele passed from parents to offspring. Jennifer had a baby brothe
    15·2 answers
  • The brain waves in rem sleep are similar to those of what stage?
    15·1 answer
  • mutation that increases the ability to store moisture in a dry environment is harmful beneficial or neutral
    8·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Why must body systems work together?
    13·1 answer
  • Why<br>is the hepatic portal<br>portal vein<br>unique ?​
    12·1 answer
  • PLEASE HELP ASAP!!!
    15·2 answers
  • 4. What is catalase?
    5·1 answer
  • Which section of the pre-mrna contains the protein-coding regions
    8·1 answer
  • The correct sequence for the five phases in the systems development life cycle (sdlc) process is?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!