1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frosja888 [35]
3 years ago
15

The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars

***.
5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'

What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).

note: there are two answers for this question
Biology
1 answer:
xxTIMURxx [149]3 years ago
8 0

Answer:

5'GATCGTAA3'

5'ATTCTAGA3'

Explanation:

As requested in the question above, the primers were presented with 8 nucleotides, with the nitrogenous bases of the DNA, and in the 5'-3 'direction.

Primers are small fragments of DNA that are used by DNA polymerase to form new strands. The primes attach to pieces on the ribbon, through the complementarity of the nitrogenous bases, serving as a template for the DNA polymerase to create the new ribbon.

DNA polymerase uses primers at the origin of replication, and can follow the path from the right or from the left, depending on the primers used, for this reason, this question has two answers.

You might be interested in
What is another name for an animal that is only a primary consumer?
lbvjy [14]
Another name for an animal that is a primary consumer would be a herbivore.
6 0
3 years ago
Heart disease is a noncommunicable disease because
tatuchka [14]

The right answer is it can be influenced by lifestyle factors.

Noncommunicable diseases - or chronic diseases - are long-term diseases of generally slow evolution. The 4 main types of noncommunicable diseases are:

* Cardio-vascular diseases (or heart diseases)

* cancers

* Chronic respiratory diseases (COPD and asthma)

* Diabetes

Noncommunicable diseases, or NCDs, are by far the leading cause of death in the world, accounting for over 63% of all annual deaths.

7 0
3 years ago
Read 2 more answers
. Si el átomo contiene electrones que son partículas con carga eléctrica negativa, ¿por qué el átomo no tiene carga
Korolek [52]

Answer:

Si el átomo contiene electrones que son partículas con carga eléctrica negativa, ¿por qué el átomo no tiene carga eléctrica neta? A. Porque la carga de los electrones de un átomo se equilibra con la de los electrones de los átomos vecinos.

Explanation:

espero te sirva

8 0
3 years ago
Read 2 more answers
The fact that teenagers often feel like adults far earlier than they develop the ability to make sensible, well-thought-out deci
vichka [17]

Answer: The fact that teenagers often feel like adults far earlier than they develop the ability to make sensible, well-thought-out decisions reflects the fact that the limbic system often matures more quickly than the frontal lobe.

The correct option is D (limbic system; frontal)

Explanation:

4 0
3 years ago
Read 2 more answers
What reinforcements could be used to enable your memory better?
hram777 [196]

Answer:

chewing gum

Explanation:

when chewing gum you'll likely think back to the last time you had gum. The trick is to study while chewing gum and, when you chew another piece of gum, you'll remember back to when you had it earlier along with the information that you remembered as you were chewing the gum.

8 0
3 years ago
Other questions:
  • I will give brainliest first person please Sean and Tommy are debating the positive and negative impacts of technology on enviro
    5·1 answer
  • Enhancer i can stimulate the transcription of gene a, but the insulator blocks its effect on gene
    14·1 answer
  • All of the following are true of Biotic factors except for ?
    10·1 answer
  • How and why does the latitude of a place on earth affect its average temperature?
    13·1 answer
  • Where can ribosomes be found in addition to on the rough endoplasmic reticulum?
    10·1 answer
  • What do all prokaryotes and eukaryotes have in common ?
    8·2 answers
  • Most terrestrial biomes are defined by their average annual temperature and precipitation
    8·1 answer
  • Adiós gente bye People uwu :3
    14·2 answers
  • Can you think of any animals that undergo metamorphosis ?
    14·2 answers
  • A student wants to find out if a particular kind of plant grows better with or without potting soil. She has two identical plant
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!