1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frosja888 [35]
3 years ago
15

The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars

***.
5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'

What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).

note: there are two answers for this question
Biology
1 answer:
xxTIMURxx [149]3 years ago
8 0

Answer:

5'GATCGTAA3'

5'ATTCTAGA3'

Explanation:

As requested in the question above, the primers were presented with 8 nucleotides, with the nitrogenous bases of the DNA, and in the 5'-3 'direction.

Primers are small fragments of DNA that are used by DNA polymerase to form new strands. The primes attach to pieces on the ribbon, through the complementarity of the nitrogenous bases, serving as a template for the DNA polymerase to create the new ribbon.

DNA polymerase uses primers at the origin of replication, and can follow the path from the right or from the left, depending on the primers used, for this reason, this question has two answers.

You might be interested in
I NEED HELP I WILL MARK BRAINLEST IF YOU ARE CORRECT
Nezavi [6.7K]

Answer:

What's up? ^^

Explanation:

5 0
3 years ago
Read 2 more answers
What is a genotype? *
erastova [34]

Answer:

The genetic constitution of an individual orgasm.

Explanation:

5 0
4 years ago
Read 2 more answers
Although cells have differences that reflect their specific functions in the body, what functions do they have in common?
madam [21]
<span>All cells have a nucleus, which contains the genetic material of the cell. Also, all cells have a mitochondrion, the powerhouse of the cell. Finally, all cells have ribosomes, cell membranes, and cytoplasm. These parts of the cell do the same thing regardless of where they are in the body.</span>
4 0
3 years ago
How do plants compensate for the constant loss of water by transpiration?
romanna [79]

Answer:

Transpiration is the evaporation of water from the surface of leaf cells in actively growing plants. ... If water loss is greater than water uptake, air bubbles can form in the xylem. Plants reduce water loss by closing their stomata, developing thick cuticles, or by possessing leaf hairs to increase the boundary layer.

7 0
3 years ago
Shaniah has a very high-pitched voice, If she was examined, what would she be<br> found to have?
Pavel [41]

she might have vocal chord paralysis or vocal chord nodules/polyps. it might also be vocal chords being stretched too much and puberty.

3 0
3 years ago
Other questions:
  • How are nucleotide different from each other
    12·1 answer
  • Heat escaping the core creates what in the next layer
    5·1 answer
  • Females inherit two x chromosomes and males inherit one x chromosome. however, there is not a double dose of x gene products in
    9·2 answers
  • As the Sun moves throughout the day, some plants can follow it. This is called _____.
    11·1 answer
  • What sort of stimuli does a named potted plant respond to ?
    15·1 answer
  • HELLLLPPP IT'S URGENT!
    5·1 answer
  • On your Spring Break in Mexico, you take a break to count the starfish in a tidal pool. You notice that there is a rare recessiv
    13·1 answer
  • Directions: Respond to the prompts below to demonstrate your understanding of the reading.
    7·1 answer
  • Your friend wants to have her DNA tested because she thinks it will help her identify what foods she should eat. What is your ad
    9·1 answer
  • What did the petition of right aim to prevent the monarch from doing? choose three answers.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!