1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frosja888 [35]
3 years ago
15

The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars

***.
5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'

What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).

note: there are two answers for this question
Biology
1 answer:
xxTIMURxx [149]3 years ago
8 0

Answer:

5'GATCGTAA3'

5'ATTCTAGA3'

Explanation:

As requested in the question above, the primers were presented with 8 nucleotides, with the nitrogenous bases of the DNA, and in the 5'-3 'direction.

Primers are small fragments of DNA that are used by DNA polymerase to form new strands. The primes attach to pieces on the ribbon, through the complementarity of the nitrogenous bases, serving as a template for the DNA polymerase to create the new ribbon.

DNA polymerase uses primers at the origin of replication, and can follow the path from the right or from the left, depending on the primers used, for this reason, this question has two answers.

You might be interested in
What processes turn sediment into sedimentary rock?
Mice21 [21]
         The processes that turns sediment into sedimentary rock is the compaction and cementation of sediment. Hope this helps!
4 0
3 years ago
Read 2 more answers
In the fossil record, there is no evidence of anything living on land before plants. Why are plants necessary before more compli
stiv31 [10]

Answer:

maybe option D is correct

6 0
3 years ago
The hydrologic, rock, and tectonic cycles are all interconnected. In the rock cycle, water moves regolith during _____, and the
iren [92.7K]
 <span>The hydrologic, rock and tectonic cycles are all interconnected. In the rock cycle, water moves regolith during EROSION, and the tectonic cycle resurfaces rock through UPLIFTING. 

In short, the answer would : erosion, uplifting.

Hope this helps !

Photon</span>
8 0
3 years ago
Read 2 more answers
What is cellular respiration? Why is it important for cells to go through cellular respiration (Give me 3 reasons -hint has to d
romanna [79]

Answer:

The term cellular respiration refers to the biochemical pathway by which cells release energy from the chemical bonds of food molecules and provide that energy for the essential processes of life. All living cells must carry out cellular respiration. Cellular Respiration uses ATP as energy.

Explanation:

8 0
3 years ago
Protein are digested and transported by fellow protein. Give vivid examples to support the statement
Nonamiya [84]

Answer and Explanation:

The transport and digestion of proteins is done by other proteins called enzymes. An example of this occurs in the biochemical digestion of proteins, where the enzyme pepsin promotes digestion, the breakdown of proteins into smaller pieces, through hydrolysis which is the breakdown of molecules with the use of water. These pieces of the protein are transported to the duodenum where they are digested again by the enzyme enterokinase.

8 0
3 years ago
Other questions:
  • How many carbon atoms are in one molecule of pryuvic acid
    9·1 answer
  • In the exercise-depression study by Blumenthal et al. (the SMILE study), which of the treatments had the best success when consi
    9·1 answer
  • For each FADH2 that supplies electrons to the electron transport system, ________ ATP(s) is/are synthesized. For each NADH H tha
    5·1 answer
  • The plants that form the basis of rain forests are _____.
    9·1 answer
  • An animal dies and falls into a river. Over time sand, rock, and other material settle on top of the animal remains, completely
    13·2 answers
  • What term is used to describe the state in which molecules are evenly distributed in the available space?
    14·1 answer
  • Strains of the human papillomavirus (HPV) that cause cervical cancer express many genes that the cervical cells that they infect
    10·1 answer
  • Which best describes what happens to ATP during photosynthesis?
    5·2 answers
  • What are the abiotic and biotic factors of a Beach Coastal?
    13·1 answer
  • CAN THIOL BE FOUND IN CARBOHYDRATES?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!