1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frosja888 [35]
2 years ago
15

The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars

***.
5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'

What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).

note: there are two answers for this question
Biology
1 answer:
xxTIMURxx [149]2 years ago
8 0

Answer:

5'GATCGTAA3'

5'ATTCTAGA3'

Explanation:

As requested in the question above, the primers were presented with 8 nucleotides, with the nitrogenous bases of the DNA, and in the 5'-3 'direction.

Primers are small fragments of DNA that are used by DNA polymerase to form new strands. The primes attach to pieces on the ribbon, through the complementarity of the nitrogenous bases, serving as a template for the DNA polymerase to create the new ribbon.

DNA polymerase uses primers at the origin of replication, and can follow the path from the right or from the left, depending on the primers used, for this reason, this question has two answers.

You might be interested in
How might alterations in dna structure be harmful to an organism?
Thepotemich [5.8K]
Changes in the dna are called mutations. They can occur spontaneously. Mutations can only be passed down in gametes--sperm and egg cells. with Darwins theory at mind a mutation needs to pass the test of natural selection to remain in the gene pool. So purposly making mutation or altercations may end in diseases/illnesses or in some cases death because they body can not take it.....hope this helps if it doesnt im sorry!
5 0
3 years ago
Which device measures current by using the reflections of a coil of wire placed in a permanent magnetic field?
pashok25 [27]

Answer:

a radio uses the reflections of a coil of wire placed in a permanent magnetic field.

5 0
3 years ago
Do more complex organisms always have more chromosomes than simpler organisms do
o-na [289]
Yes because I think that more-complex cells need the chromosomes for help
4 0
3 years ago
Based on this diagram, do you think that organisms of the same order will share a stronger evolutionary relationship than organi
Gelneren [198K]
In taxonomic, the organism is classified based on some similarities. In upper division, the similarities should be more general and in the lower division, the similarities will be more specific. It was mostly based on an organ, example: vertebrate.
An organism with the same phylum could be put in different order.
But the organism with the same order should have the same phylum and class too since order is located below the phylum. That means the organism with the same order should have more similarities than the organism with the same phylum. Those similarities are tightly correlated with the evolutionary relationship.
The image is not really helping since it was showing kingdom division, not the sequence of the taxonomic division.
4 0
3 years ago
Help me out with this please
Schach [20]
1. Spongebob
2. Who gets the muscle cream
3. Muscle growth
4. Since the cream is advertising more muscle growth than average, patrick’s muscles should be double the size of Spongebob’s.
7 0
3 years ago
Other questions:
  • ____ on the blood determine a person’s blood type.
    12·2 answers
  • Do you think scientists have an ethical obligation to speak out when a problem seems so severe
    15·1 answer
  • When scientist compare two or more object what are they looking for?
    12·1 answer
  • Total these measurements. Your answer should indicate the proper accuracy. Include units.
    15·1 answer
  • An RNA molecule folds back upon itself to form a "hairpin" structure held together by a region of base pairing. One segment of t
    10·1 answer
  • The active transport of solutes across a membrane is typically coupled to which type of reaction?
    10·1 answer
  • What is acrosomal reaction???​
    13·2 answers
  • Which of the following is NOT a characteristic of life? Also, explain why and I give you a 5 stars.
    14·1 answer
  • What is FnUvCvK? And why it is so popular​
    14·1 answer
  • Which abiotic resource is not likely present in the Texas blind salamander's environment?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!