1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frosja888 [35]
3 years ago
15

The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars

***.
5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'

What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).

note: there are two answers for this question
Biology
1 answer:
xxTIMURxx [149]3 years ago
8 0

Answer:

5'GATCGTAA3'

5'ATTCTAGA3'

Explanation:

As requested in the question above, the primers were presented with 8 nucleotides, with the nitrogenous bases of the DNA, and in the 5'-3 'direction.

Primers are small fragments of DNA that are used by DNA polymerase to form new strands. The primes attach to pieces on the ribbon, through the complementarity of the nitrogenous bases, serving as a template for the DNA polymerase to create the new ribbon.

DNA polymerase uses primers at the origin of replication, and can follow the path from the right or from the left, depending on the primers used, for this reason, this question has two answers.

You might be interested in
What is the placenta, and what is its role in fetal circulation?
mote1985 [20]

The prenatal circulation of blood is different than the postnatal circulation, mainly because the lungs are not in use. The fetus obtains oxygen and nutrients from the mother through the placenta and the umbilical cord. Blood from the placenta is carried to the fetus by the umbilical vein.

7 0
4 years ago
Both of the regular intravenous solutions administered in medicine, normal saline and lactated Ringer’s solution, are isotonic
larisa86 [58]

Answer:

Both of the regular intravenous solutions administered in medicine, normal saline and lactated Ringer’s solution, are isotonic. Why is this important?

Explanation:

<em>Because the isotonic saline solution</em> has a sodium concentration similar to that of blood.

ISOTONIC SOLUTIONS: <em>The osmolarity of the isotonic fluid approximates the osmolarity of serum plasma. </em>Isotonic fluids are used to hydrate the intravascular compartment in situations of significant fluid loss, such as dehydration, bleeding, etc.

4 0
3 years ago
Which of these is an advantage of hydroelectric energy
marishachu [46]

Answer:

B. reduce greenhouse gas emissions

Explanation:

The hydroelectric energy has its pros and cons as most of the energy production facilities do. One of the biggest advantages of the production of this type of energy is that it almost doesn't emit any greenhouse gases into the atmosphere. Considering the problem that the world is facing because of it, especially the climate changes and rising sea levels because of that, this is seen as a very big plus for any type of energy production. This has resulted in the building of more and more dams that produce hydroelectric energy, some of which have been made very large and very large energy production.

8 0
4 years ago
Help me plsssssssssssssss
horrorfan [7]

Answer:

it is the one you have selected, (C)

Explanation:

8 0
3 years ago
Read 2 more answers
Could somebody please help me?
riadik2000 [5.3K]

Answer: The answer is Oxygen.

7 0
3 years ago
Other questions:
  • Explain the different parts of an enzyme-substrate complex.
    9·1 answer
  • This area of the brain is not fully developed during the teenage years and is
    5·1 answer
  • Which stamens correctly describe the rock cycle
    13·2 answers
  • The species of plasmodium that cause the disease malaria are found in
    9·1 answer
  • Consuming a meal high in salt will:_________. a. activate the renin-angiotensin mechanism. b. result in a temporary increase in
    9·2 answers
  • If a subtance cannot be broken down chemically into a simpler subtance, what is it?
    11·1 answer
  • Describe three methods by which the reproductive behavior of individuals can affect the growth rate of a population
    14·1 answer
  • Which of these modes of transmission require a bodily opening either natural or artificial?
    10·1 answer
  • ____ is a type of weathering where rock is dissolved by an acid.
    13·1 answer
  • Who was the first person to connect a patient's symptoms to their actual autopsy findings?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!