1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frosja888 [35]
2 years ago
15

The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars

***.
5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'

What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).

note: there are two answers for this question
Biology
1 answer:
xxTIMURxx [149]2 years ago
8 0

Answer:

5'GATCGTAA3'

5'ATTCTAGA3'

Explanation:

As requested in the question above, the primers were presented with 8 nucleotides, with the nitrogenous bases of the DNA, and in the 5'-3 'direction.

Primers are small fragments of DNA that are used by DNA polymerase to form new strands. The primes attach to pieces on the ribbon, through the complementarity of the nitrogenous bases, serving as a template for the DNA polymerase to create the new ribbon.

DNA polymerase uses primers at the origin of replication, and can follow the path from the right or from the left, depending on the primers used, for this reason, this question has two answers.

You might be interested in
Public dissent in America led to a plan being devised to create an independent Philippines, which was established in:
liq [111]

Answer:

C but im not sure

Explanation:

Correct me if its wrong

6 0
2 years ago
If the mean amount of glucose produced at 10 min is 580mg/dL, what is the rate of
Assoli18 [71]

Answer:

hi

Explanation:

bye

6 0
3 years ago
Plants in hot environments like deserts open their stomata at night because they are adapted to
stepan [7]

Answer:

To reduce water loss.

Explanation:

Keeping the stomata closed during the day, helps reduce water loss when dry, hot wind blows across it.

3 0
1 year ago
During gamete formation, each allele of a pair for a gene moves to separate gametes. Which principle is indicative of this state
TiliK225 [7]
Think about the actual physical process happening in the cell - the allele (or versions of a gene) are literally physical pieces of DNA strung together into chromosomes. And as the cell divides to form gametes, those chromosomes randomly assort themselves into the two new cells (conditional that each new cell gets one copy of each chromosome, in the case of gametes)...<span>
</span>
6 0
3 years ago
How does a chemical equation support the law of conservation of matter?
alukav5142 [94]
Matter cannot be created or destroyed in chemical reactions. This is the law of conservation of mass. In every chemical reaction, the same mass of matter must end up in the products as started in the reactants. Balanced chemical equations show that mass is conserved in chemical reactions.
4 0
2 years ago
Other questions:
  • If you wanted to show all of the feeding relationships in a particular ecosystem, what type of diagram would be most effective
    12·1 answer
  • Describe why the S phase is important to a cell.
    14·1 answer
  • Solar radiation travels through the earth's atmosphere and warms the planet's surface. Greenhouse gases like carbon dioxide in t
    11·2 answers
  • What kind of atom tens to lose one electron
    12·1 answer
  • How do antibiotics help your immune system deal with infectious agents?
    11·2 answers
  • How is energy transferred from the Sun, then cycled through all living organisms in an ecosystem?
    15·1 answer
  • What important mathematical manipulations should be performed on qualitative data?
    13·1 answer
  • What's an advantage of using a light microscope instead of an electron microscope
    7·1 answer
  • Which is most likely to promote the growth of animals?
    14·1 answer
  • How do the bamboo leaves at the top of the plant get the water they need from the bamboo roots?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!