1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frosja888 [35]
2 years ago
15

The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars

***.
5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'

What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).

note: there are two answers for this question
Biology
1 answer:
xxTIMURxx [149]2 years ago
8 0

Answer:

5'GATCGTAA3'

5'ATTCTAGA3'

Explanation:

As requested in the question above, the primers were presented with 8 nucleotides, with the nitrogenous bases of the DNA, and in the 5'-3 'direction.

Primers are small fragments of DNA that are used by DNA polymerase to form new strands. The primes attach to pieces on the ribbon, through the complementarity of the nitrogenous bases, serving as a template for the DNA polymerase to create the new ribbon.

DNA polymerase uses primers at the origin of replication, and can follow the path from the right or from the left, depending on the primers used, for this reason, this question has two answers.

You might be interested in
Some organisms reproduce sexually. Other organisms reproduce asexually. What are some benefits of asexual reproduction?
iogann1982 [59]

Answer:

3

Explanation:

because you don't have to ...you know

8 0
2 years ago
Read 2 more answers
____ is the process of water vapor turning back into liquid water, with the best example being those big, fluffy clouds floating
ankoles [38]

Answer:

Your answer is condensation.

7 0
2 years ago
What type of virus attacks neurons in the nervous system, causing paralysis and other neurological issues?(1 point)
Vikki [24]

Answer:

B. Polio

Explanation:

The poliovirus causes brain damage (resulting in paralysis) and muscle degeneration. You're welcome.

4 0
3 years ago
Justin has decided that he wants to involve his employees in all of the different steps of decision making: identifying problems
adoni [48]

Justin has decided that he wants to involve his employees in all of the different steps of decision-making: identifying problems, generating alternatives, selecting solutions, planning implementations, and evaluating results. If he does this, he can expect that employee performance and job satisfaction will increase.

<h3>What is job satisfaction?</h3>

A measure of a worker's contentment with their job, whether they like the job or specific features or facets of occupations, such as the nature of the job or supervision, is called job satisfaction, employee satisfaction, or work satisfaction. The cognitive (or evaluative), affective (or emotional), and behavioral components of job satisfaction can all be assessed. Researchers have also highlighted that different job satisfaction measures vary in how much they represent thoughts or feelings about the job.

Employee performance is characterized by how well they carry out their job responsibilities and complete their assigned tasks. It speaks to the usefulness, excellence, and efficacy of their output. Performance is a factor in how valuable we consider each person to be to the company.

To know more about job satisfaction refer to: brainly.com/question/7873593

#SPJ1

7 0
1 year ago
T. Write a Definition for cellular respiration in your own words.
sergeinik [125]
1. When organisms break down the bonds of sugar molecules they get energy. The energy is then used to make a module of ATP, which gives all organisms their energy.

2. All living things

3.
C6H12O6+O2-->CO2+H2O+ ENERGY(ATP) Glucose+Oxygen>Water+Carbon Dioxide+ Energy
6 0
2 years ago
Other questions:
  • Monocots and dicots are both members of which plant group? nonvascular plants gymnosperms ferns angiosperms
    8·1 answer
  • The graph shows levels of primary and secondary immune responses versus time. The secondary response is greater and more rapid t
    13·2 answers
  • When nerve cells in the nervous system cease to divide, they are in
    5·1 answer
  • I just bombed this test and i have 1 retake left. please help!!
    6·1 answer
  • The hypothetical island country of Gilder lies in the Mediterranean Sea off the coast of
    15·2 answers
  • Some conifers lose their needles seasonally, just as deciduous trees do.<br> True<br> False
    7·2 answers
  • Are water and CO2 matter?
    5·2 answers
  • Camels have flat hoofs and valved nostrils.<br> 4.
    12·1 answer
  • Having two alleles for the same trait
    7·1 answer
  • What are the functions of the pioneer community look at the pic
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!