1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frosja888 [35]
2 years ago
15

The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars

***.
5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'

What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).

note: there are two answers for this question
Biology
1 answer:
xxTIMURxx [149]2 years ago
8 0

Answer:

5'GATCGTAA3'

5'ATTCTAGA3'

Explanation:

As requested in the question above, the primers were presented with 8 nucleotides, with the nitrogenous bases of the DNA, and in the 5'-3 'direction.

Primers are small fragments of DNA that are used by DNA polymerase to form new strands. The primes attach to pieces on the ribbon, through the complementarity of the nitrogenous bases, serving as a template for the DNA polymerase to create the new ribbon.

DNA polymerase uses primers at the origin of replication, and can follow the path from the right or from the left, depending on the primers used, for this reason, this question has two answers.

You might be interested in
Which of the following choices is a goal of science?
Tanzania [10]
B. To explain how things work
4 0
2 years ago
Read 2 more answers
Help! Will give brainliest to the best answer.
ohaa [14]
A nonnative species may not have any natural predators when being introduced subsequently it won’t have any competition with the other organisms living in the same ecosystem. This will make the other organisms struggle for food and other resources and could potentially make them go extinct. They can also have drastic effects to the local biodiversity (for the previous reason). Also, due to the competition or newly introduced predator (assuming they’re a predator) the preexisting organisms of the ecosystem may start to relocate and start a new ecosystem or if there are neighbouring towns/cities may have to forage for food there - which would obviously be dangerous for both them and us. Hope these few examples help.
8 0
3 years ago
Which of the following best describes how the size and shape of a cell affect its ability to obtain nutrients from its surroundi
fredd [130]

Answer:

A smaller cell has fewer organelles dependent upon nutrient uptake and will acquire them more quickly.

Explanation:

the larger the cell the more distance matter must travel within the cell. if the cell was larger there would be a waste of space in the cell and it would take longer for proteins and enzymes to travel about the cell.

5 0
3 years ago
Which of the following accurately describes immWhich of the following accurately describes immunity?
AlexFokin [52]
The answer should be option "b" 
6 0
3 years ago
Which best compares the respiratory system to the circulatory system?
andrew11 [14]

Respiratory system is refers to as the organs which are involved in breathing such as nose, throat, larynx, trachea, bronchi, and lungs. It is also known as respiratory tract.

The  circulatory system  is refer to as which contains the heart and the blood vessels and blood moves throughout the body in vessels. This circulatory system helps tissues to get enough oxygen and nutrients, and it helps them get rid of waste products.

<h3></h3><h3>What is breathing?</h3>

When person inhale (breathe in), air enters in the lungs, and oxygen from atmosphere moves to body blood. At the same time, carbon dioxide, a waste gas, moves from blood to the lungs and is exhaled (breathed out).

Breathing process is known as gas exchange which is is essential to life.

For more information regarding breathing, visit:

brainly.com/question/15001725

#SPJ

8 0
2 years ago
Other questions:
  • Dinobryon is a species of protozoa that reproduces asexually. How is it better for the survival of the species for the protozoa
    8·2 answers
  • Fourteen students are working on the experiment is this observation or inference
    10·1 answer
  • Which gases are carried by red blood cells? Select two options.
    13·2 answers
  • Which of the following describes the role that enzymes play in the process of metabolism? A. Enzymes store the chemical energy t
    15·1 answer
  • Give an example of an acid you can drink?
    14·2 answers
  • Explain how deposition in a basin leads to the formation of sedimentary rock
    10·1 answer
  • If 10 glucose molecules enter the Krebs Cycle, how many possible molecules of ATP can be produced?
    12·1 answer
  • What determines the categorization of fungi?
    15·1 answer
  • All of the following are functions of proteins except?
    10·2 answers
  • Plz help<br>name the parts of the virus labeled x and y ​
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!