1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frosja888 [35]
3 years ago
15

The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars

***.
5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'

What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).

note: there are two answers for this question
Biology
1 answer:
xxTIMURxx [149]3 years ago
8 0

Answer:

5'GATCGTAA3'

5'ATTCTAGA3'

Explanation:

As requested in the question above, the primers were presented with 8 nucleotides, with the nitrogenous bases of the DNA, and in the 5'-3 'direction.

Primers are small fragments of DNA that are used by DNA polymerase to form new strands. The primes attach to pieces on the ribbon, through the complementarity of the nitrogenous bases, serving as a template for the DNA polymerase to create the new ribbon.

DNA polymerase uses primers at the origin of replication, and can follow the path from the right or from the left, depending on the primers used, for this reason, this question has two answers.

You might be interested in
Whats the definition of dura matter
STatiana [176]

Answer:the tough outermost membrane enveloping the brain and spinal cord

Explanation:

8 0
3 years ago
Read 2 more answers
A local area's short-term atmospheric condiſions are known
SashulF [63]

Answer:

O weather, climate

Explanation:

A local area's short-term atmospheric conditions are known  as weather while long term conditions are known as  climate.

I hope this helped :)

7 0
3 years ago
You observe a cell in a stained section of connective tissue. The cell has an indented nucleus and obvious cytoplasmic granules.
defon
You observe a cell in a stained section of connective tissue. The cell has an indented nucleus and obvious cytoplasmic granules. Upon further testing, you determine that the granules contain histamine. This cell is most likely a(n) _____.

mast cell
3 0
3 years ago
Because of __________ between moving parts of a bicycle, some of the work you do changes to energy.
swat32

Answer:

friction

Explanation:

5 0
3 years ago
Where does the energy come from to make ATP in the light reactions?
Dominik [7]

Answer:

Figure 19.2. The Light Reactions of Photosynthesis. Light is absorbed and the energy is used to drive electrons from water to generate NADPH and to drive protons across a membrane. These protons return through ATP synthase to make ATP.

Explanation:

thank me later

6 0
3 years ago
Other questions:
  • Why are men's voices lower than women's voices?
    12·2 answers
  • Fissure is the term that generally refers to the depression between
    9·1 answer
  • Describe the structure and function of capillaries.
    11·1 answer
  • Emily writes on both sides of her paper at school. her family also recycles newspapers at home. which natural resource is emily
    14·1 answer
  • All of the following describe the molecular/cellular changes that occur in cones in response to light, except one. Choose the ex
    8·1 answer
  • Agrobacterium infects plants and causes them to form tumors. You determine that tumor formation requires a large amount of the p
    13·1 answer
  • Question 9 (2 points)
    14·1 answer
  • Compare and contrast a virus to a cell. What would be some differences? What are some similarities?
    14·1 answer
  • What does homeostasis have to with life today
    13·1 answer
  • 8.<br> What are different types of Renewable Energy?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!