1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frosja888 [35]
3 years ago
15

The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars

***.
5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'

What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).

note: there are two answers for this question
Biology
1 answer:
xxTIMURxx [149]3 years ago
8 0

Answer:

5'GATCGTAA3'

5'ATTCTAGA3'

Explanation:

As requested in the question above, the primers were presented with 8 nucleotides, with the nitrogenous bases of the DNA, and in the 5'-3 'direction.

Primers are small fragments of DNA that are used by DNA polymerase to form new strands. The primes attach to pieces on the ribbon, through the complementarity of the nitrogenous bases, serving as a template for the DNA polymerase to create the new ribbon.

DNA polymerase uses primers at the origin of replication, and can follow the path from the right or from the left, depending on the primers used, for this reason, this question has two answers.

You might be interested in
What are the characteristics of an indicator species
LenKa [72]
An indicator species<span> is an organism whose presence, absence or abundance reflects a specific environmental condition. </span>Indicator species<span> can signal a change in the biological condition of a particular ecosystem, and thus may be used as a proxy to diagnose the health of an ecosystem.

</span>
8 0
3 years ago
What do we call the process where part of the DNA is saved during replication?
Nataly_w [17]

Answer:

The process where part of the DNA is saved during replication is known as semi conservative replication.

Explanation:

During cell division, a cell must first replicate its DNA (Deoxyribonucleic acid).  When a cell divides into daughter cells , the DNA of the parent cell must be copied because DNA contains the genetic material of an organism. DNA replication is the process in which DNA is copied  during the cell  division cycle.  During replication, the complementary strands of the original double helix DNA are separated and one of the two strands in the original molecule is saved in the new DNA molecule. Thus the new DNA molecule is made of an original strand and a newly synthesized strand. So the DNA replication is known as semi conservative replication. Each strand of the original DNA molecule is referred as the template strand because it provides information for the production of newly synthesized strand. It takes place inside the nucleus of a cell during the s stage  of the cell cycle. During replication, helicase enzyme breaks the hydrogen bonds between the complementary bases (Adenine with Thymine, Cytosine with Guanine) and unwinds the double helix of DNA. The two separated strands create a Y-shaped replication fork and act as templates for the synthesis of new strands of DNA. Enzymes known as DNA polymerases create the new strands.

6 0
3 years ago
Why are the symptoms of vascular neurocognitive disorder so different in each patient?
Mademuasel [1]
Each patient is different from any other ,
8 0
4 years ago
Which of these is a function of the cell membrane in all cells?
Rus_ich [418]
I believe it is B. Hope this helps!!
8 0
3 years ago
What Are Antibiotics And What Are The Precautions That Must Be Taken While Taking Antibiotics?​
irina [24]

Antibiotics should be taken under the supervision of a well qualified doctor. Course (intake) of antibiotics should be completed as prescribed by the doctor. Antibiotics should be taken in the right amount and at the right time. A wrong dose of antibiotics makes the drug ineffective.Explanation:

7 0
3 years ago
Other questions:
  • An organism that reproduces sexually has a diploid number of 30. how many chromosomes will a gamete of this organism have?
    7·2 answers
  • Paving a large parking lot could interrupt or hurt which of the following?
    13·1 answer
  • The first towns and cities appeared in:
    7·1 answer
  • Describe the theory of plate tectonics and how it explains the presence of fossils from the same plants and animals in locations
    7·1 answer
  • The energy source for the synthesis of carbohydrates in the Calvin cycle is
    15·1 answer
  • Krypton is named after the Greek word that means “secret.” Which explains why krypton was most likely given this name? Krypton i
    15·2 answers
  • Why can lichens be used as living indicators of air pollution
    12·1 answer
  • Cells produced by the root and shoot tip meristems become the tissues of the plant body.
    15·2 answers
  • The molecule that serves as the major source of readily available fuel for neurons and blood cells is ________.
    10·1 answer
  • which of the following statements about gene flow is false? group of answer choices it leads to divergence and the formation of
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!