1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
True [87]
3 years ago
7

How many types of joints are there in the human body?

Biology
2 answers:
hram777 [196]3 years ago
8 0

Number D.six is the answer.

attashe74 [19]3 years ago
6 0

Answer:

A because there are four main types of joint i can mention some but not all bolt and nut joint, socket joint and grill joint

You might be interested in
The barrel of a gun is also known as what? Rifle Caliber Bore Gauge
Trava [24]
I think the correct answer from the choices listed above is the third option. The barrel of a gun is also known as bore. The barrel is the metal tube which the bullet is fired and the bore is the inside of the barrel. It is the one closest to the barrel so it must be the answer.
6 0
4 years ago
Read 2 more answers
Josiah says this is a phylogenetic tree of the dinosaurs. Maleek says it is a cladogram of the dinosaurs. Who is correct?
Verdich [7]

C. Both are correct,

5 0
3 years ago
Read 2 more answers
Duck-billed platypus is called a bridge animal, why?​
xxMikexx [17]

Answer:

The platypus serves as a 'bridge' animal between nonmammals like birds and reptiles, which maintain their testicles in their body cavity, and placental and marsupial mammals, which hold their testes in an external scrotum."

4 0
3 years ago
Which characteristic do all prokaryotes and eukaryotes share?
Vsevolod [243]
 cells all feature a nucleus, and their organelles are enclosed inside 
4 0
3 years ago
Read 2 more answers
The famous fossil lucy was classified as what species
dmitriy555 [2]
 <span>Australopithecus afarensis</span>
3 0
3 years ago
Other questions:
  • 1. Generally, people water their plants with
    10·1 answer
  • How does water affect mass movements and how do I put it in my analysis?
    9·1 answer
  • What is the relationship of rocks to soil? Rocks make up soils. Soil is made of small rocks. Rocks produce soil. Soil produce ro
    8·1 answer
  • In humans, pharyngeal slits are present in the embryo and develop into the __________ during maturation.
    7·1 answer
  • A 45-year-old man has received a series of immunizing drugs in preparation for a trip to a developing country. within hours, his
    8·1 answer
  • How can a mutation in a gene lead to a new trait in an organism?
    15·2 answers
  • Primary lactose maldigestion results from ________.
    14·1 answer
  • What will happen if the number of snakes goes down?
    15·1 answer
  • What is a major role that fungi play in ecosystems
    8·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!