1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Eddi Din [679]
3 years ago
8

5. [1 mark]

Biology
1 answer:
ycow [4]3 years ago
4 0

Answer:

D. Analysis of the proteins

Explanation:

You might be interested in
Which group is more likely to survive significant environmental change, one like black-footed ferrets with almost no variation o
Shkiper50 [21]
Mountain lions with lots of variation because variation is important for species’ survival. If there is an environmental change that negatively affects organisms with a certain trait, variation can insure that the entire species will not be wiped out because some organisms within that species might not have that trait and can survive.
3 0
3 years ago
Please help me. Giving 15 points if you help.
Advocard [28]

Answer:

76

Explanation:

3 0
3 years ago
In a tissue-culture lab, a scientist prepared somatic embryos of a banana. He wants to induce root development. Which hormone ty
Leni [432]

the answer is A (cytokinins)

3 0
3 years ago
Read 2 more answers
The amount of enzyme activity in a cell that is homozygous for a mutant allele is 400 units. The amount of enzyme activity in a
nikklg [1K]
<h2>Hypomorphic allele</h2>

Explanation:

  • Hypomorphic Alleles : A change that reduces, however, doesn't dispense with a gene's usefulness is hypomorphic. A progressively extreme condition, amorphic transformation, dispenses with the gene's capacity.
  • The great analyses characterizing hypomorphic alleles go back to the 1930s. Herman Miller, who won a Nobel Prize for finding that radioactivity causes changes, considered the eyeshade of organic product flies. These flies typically have red eyes, yet freak assortments can have white or apricot-hued eyes. The allele liable for various natural product fly-eye hues is known as the white allele, with the contraction "w."

8 0
3 years ago
What controls how high and low tides will be
alekssr [168]

Answer:

The moon.

Explanation:

High tides and low tides are caused by the Moon. The Moon's gravitational pull generates something called the tidal force. The tidal force causes Earth—and its water—to bulge out on the side closest to the Moon and the side farthest from the Moon.

7 0
3 years ago
Read 2 more answers
Other questions:
  • In Epic, which tool should you use to find information related to a particular condition?
    15·1 answer
  • The early classification system for plants and animals was developed by __________. A. Aristotle B. Darwin C. Linnaeus D. Newton
    8·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • 4. There are three codons that signal the end of synthesis, these are called STOP codons.
    7·1 answer
  • What do the arrows represent in a food web? Which ones are right
    9·1 answer
  • Idk this one is give u a brainlist if u answer right with explanation
    15·2 answers
  • What gases are <br> in the mitochondria
    5·1 answer
  • Mixture
    12·2 answers
  • Why is the permeability of
    14·1 answer
  • what potentially negative consequences might some biofuels have that prevent them from being a total replacement for fossil fuel
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!