1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
matrenka [14]
3 years ago
14

Ryder needs to determine the missing term in this set:

Biology
2 answers:
Bogdan [553]3 years ago
5 0

Answer:

The correct answer is option D. "fertilization".

Explanation:

Human fertilization is defined as the union between a sperm and an egg, which marks the beginning of a new life and the basis of human reproduction. The result of fertilization is the production of a zygote cell, a cell which genome is formed of a combination of both the sperm's and the egg's genome. As could be noted, the term "fertilization" is closely related with the terms "sperm", "egg" and "zygote". Therefore, "fertilization" is the term that best completes the set.

KATRIN_1 [288]3 years ago
4 0
It would be D, fertilization.
You might be interested in
A student studies art and learned that he has several layers including inner and outer cores the student will make a model of th
nlexa [21]

Answer:

C: A solid metal ball in the middle of a pool of liquid.

Explanation:

Since the student is studying the earth, the core area is made up of a solid metal ball in the middle of a pool of a liquid.

  • The core is the inner most part of the earth.
  • It exists in the middle of the earth.
  • The core is divide into two layers; inner core and outer core.
  • The inner core is a solid ball of metal.
  • The outer core is a liquid metal under high temperature and pressure.
4 0
3 years ago
How is meiosis similar to mitosis?
Rudiy27

Answer:

Both mitosis and meiosis are processes of cell division. They use the same steps for cell division, including prophase, metaphase, anaphase and telophase. Also, mitosis produces 2 diploid cells, while meiosis produces 4 haploid cells.

Explanation:

3 0
3 years ago
Which statements accurately describe volume? Check all that apply.
kodGreya [7K]
 I believe that 5 is the best choice out of the answers given. Hope this helps and please enjoy Brainly! -ZeusROX
4 0
3 years ago
Read 2 more answers
Colonialism is defined as:______
scoundrel [369]

Answer:

a. the maintenance of political, social, economic, and cultural dominance over a people by a foreign power for an extended period

Colonialism is defined as <u>the maintenance of political, social, economic, and cultural dominance over a people by a foreign power for an extended period</u>

Explanation:

Colonialism is the military, economic,cultural oppression and domination of one country over another for an extended period. Often times colonialism was resisted through language,history and identity construction. During colonialism, people often used one of the following strategies to cope:

  • Separatism
  • Re-creation
  • Syncrestism
  • Mimicry
  • Active participation
  • Assimilation
3 0
3 years ago
Read 2 more answers
Determine tRNA anticodons<br> UACCUGUUAAGCUACAAAAUU
Pavel [41]

Answer:

i dont know sorry , Gooqle it

7 0
3 years ago
Other questions:
  • NEED HELP ASAP! WILL GIVE BRAINLIEST
    15·1 answer
  • We are pretending that I am testing to see if Vitamin C cures ashy skin. You must write out EVERY step of the study that I must
    6·1 answer
  • A zoology student is investigating whether it is true that the gender of turtles depends on the temperature at which the turtle
    10·2 answers
  • You observe several populations of a species of wildflower in your county. even though the climate is nearly identical in all th
    7·1 answer
  • To test the hypothesis that plants grow faster in green light, a student set up 3 of the same type of plants. She placed the fir
    6·1 answer
  • 6. Inside each stinging cell of an anemone is a coiled thread with a barb at the
    15·1 answer
  • Why are seedless vascular plants considered paraphyletic rather than monophyletic?
    15·1 answer
  • The oldest known fossils Group of answer choices all of the choices. are microscopic. are that of prokaryotes. date back 2.5 bil
    6·2 answers
  • Energy Pyramids represent the food chain energy and population sizes. Which statement is NOT true.
    12·1 answer
  • Earth scientists have concluded that the methods of harnessing energy that have been used over the past tWO
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!