1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Naddika [18.5K]
2 years ago
7

Please answer quickly, timed test!!

Biology
2 answers:
umka2103 [35]2 years ago
8 0

Answer:

D.

Explanation:

insulin is not found in the body

sweet [91]2 years ago
8 0

Answer:

D

Explanation:

because glycogen is NOT a form of sugar so insulin wouldn't regulate it the other person knows nothing about the body (no offense)

plz give thanks and rating and if you want to give brainlist

You might be interested in
Which of the following large-scale environmental catastrophes has the least effect on aquatic ecosystems?
JulsSmile [24]
B.
Deforestation affects ecosystems on land. there are no forests underwater

3 0
3 years ago
Read 2 more answers
The female rat has a paired set of ______ that extend towards the kidneys. these structures may contain multiple embryos
Ludmilka [50]

Answer:

two uterine horns

Explanation

Yes

3 0
3 years ago
2 students are experimenting to see if the amount of water affects who quickly it heats to 100*C. They decided to heat one beake
marysya [2.9K]
A because if you add and do the equation to all the cups
5 0
2 years ago
Interpret a diagram, name two complexes on the Golgi apparatus that might be involved in vesicle fusion.
zhuklara [117]
The Ltd receptor and cd3-y
7 0
3 years ago
What is the mRNA that would be transcribed from this strand of DNA?
Illusion [34]

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Explanation:

8 0
2 years ago
Other questions:
  • Which conclusion can be made from the data in the table? The higher the temperature, the fewer chirps there will be in 10 second
    5·2 answers
  • What is the best description of chromosomes by the end of anaphase 2 of meiosis
    12·2 answers
  • The picture on the left is from August 2006 the picture on the right is from August 2015 which of these efforts has the most inf
    10·2 answers
  • The small segments of a chromosome that help code for a trait are ...
    7·1 answer
  • Of the 8 characteristics of life (RAREHOGG), which characteristics do
    10·1 answer
  • As herds of cattle graze (eat grass in a field) they cause ground movements that bring insects to the surface. Birds use this op
    13·1 answer
  • What is independent and dependent
    15·1 answer
  • The process of cellular respiration uses glucose and oxygen to make the energy molecule of the cell. What is the name of that en
    13·1 answer
  • T/F Osmosis requires energy.<br><br> A.True<br> B.False
    8·1 answer
  • Question 9 of 25
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!