1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mariana [72]
3 years ago
12

Enter the sequence of the DNA coding strand with a 5-3 polarity. DO NOT WRITE 5 OR 3 OR 5' OR 3' IN THE BOX!

Biology
1 answer:
Charra [1.4K]3 years ago
8 0

Complete question:

Use the sequence below to answer the following questions  

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’  

5’-TGCCTAGGAGGGATCACGCATTATGC-3’  

1. Enter the sequence of the coding strand with a 5’-3’ polarity

Answer:

coding strand → 5´- GCATAATGCGTGATCCCTAGGCA -3´

Explanation:

When referring to the <u>coding strand</u>, we are talking about the sequence that turns to be the same as the mRNA that results from the transcription of the same DNI segment -switching bases T for U-.  

The coding strand receives that name because it is the sequence that codes for each amino acid composing the proteins.

When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand.  

The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5´.  

Whenever we have a DNI molecule and we need to determine which strand is the coding one, we just need to look for the presence/absence of start or stop codons.

So, in the exposed example we have two strands, but we do not know yet which one is the coding one.

Conventionally, the first strand is always the coding one. However, let us analyze it by using the presence/absence of codons.

First-strand:

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

let us write it is 5´to 3´direction

5´- GCATAATGCGTGATCCCTAGGCA -3´

now let us identify the start and stop codons in 5´⇒3´direction.

  • Start codon ⇒ ATG
  • Stop codon ⇒ TAA, TAG, TGA

5´- GCATA<u>ATG</u>CGTGATCCCTAGGCA -3´ ⇒ 1 start codon at the beginning

5´- GCA<u>TAA</u>TGCG<u>TGA</u>TCCC<u>TAG</u>GCA -3´ ⇒ 3 Stop codons

Second strand: We will do exactly the same procedure

5’-TGCCTAGGAGGGATCACGCATT<u>ATG</u>C-3’⇒ 1 start codon near the end

5’-TGCC<u>TAG</u>GAGGGATCACGCATTATGC-3’⇒ 1 stop codon at the beginning

What we did here was to identify in both provided strands, where the start and stop codons are placed. We can see that in the first strand we have the start codon near the beginning, while in the second strand we have it near the end of the sequence. From this information, we can assume that the first strand is the coding one. <em>However, you need to know that some coding sequences do not have start and stop sequences, because they might correspond to a sequence in the middle of a gene.</em>

So, the sequence of the DNA coding strand with a 5-3 polarity is

5´- GCATAATGCGTGATCCCTAGGCA -3´

You might be interested in
PLEASE HELPP ME !!!!!!!!!!
pentagon [3]
1. A
2. E
3. C
4. B
5. F
6. G
7. D
7 0
3 years ago
Which type or types of rock can become metamorphic rock?
kobusy [5.1K]
Good morning!


<span>metamorphic and igneous rocks
</span>

Only sedimentary rocks can become, by changing temperature and pressure, in metamorphic rocks.
Hugs!
7 0
3 years ago
Read 2 more answers
How do rivers affect the land they flow through
Minchanka [31]

River water contains minerals and nutrients that can be beneficial to plants on the land, helping them to grow.

4 0
3 years ago
How many atoms of carbon are present in a molecule of glucose
Ksju [112]
There are 6 carbon atoms in a glucose molecule. I hope this helps you☺
8 0
3 years ago
How do platelets form blood clot
Aleksandr-060686 [28]

Answer:

They'll form a mesh that plugs what ever injury. The platelets can change its round shape to a spiny shape and will release substances that entrap more platelets. Proteins will enlargen and become a Blood Clot.

5 0
2 years ago
Other questions:
  • Viruses are known to infect every type of organism, including bacteria.<br><br> True<br> False
    5·2 answers
  • What is responsible for setting up the differences between the tropical, temperature, and polar zones?
    10·2 answers
  • What plays many roles in the body and determines many traits
    5·1 answer
  • Which structure provides energy to the cell?
    9·2 answers
  • Which component of the meninges is responsible for removing metabolic wastes?
    15·2 answers
  • What happens in exponential growth as the population gets larger?
    11·1 answer
  • The energy available at the trophic level that has secondary consumers is 50 kilocalories. How much of this energy is most likel
    13·1 answer
  • What are 3 adaptations that animals living in the tropical rainforest have?
    9·1 answer
  • Pls answer this question 2 this question has two right options
    13·1 answer
  • Kinetic energy is the energy of
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!