1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mariana [72]
3 years ago
12

Enter the sequence of the DNA coding strand with a 5-3 polarity. DO NOT WRITE 5 OR 3 OR 5' OR 3' IN THE BOX!

Biology
1 answer:
Charra [1.4K]3 years ago
8 0

Complete question:

Use the sequence below to answer the following questions  

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’  

5’-TGCCTAGGAGGGATCACGCATTATGC-3’  

1. Enter the sequence of the coding strand with a 5’-3’ polarity

Answer:

coding strand → 5´- GCATAATGCGTGATCCCTAGGCA -3´

Explanation:

When referring to the <u>coding strand</u>, we are talking about the sequence that turns to be the same as the mRNA that results from the transcription of the same DNI segment -switching bases T for U-.  

The coding strand receives that name because it is the sequence that codes for each amino acid composing the proteins.

When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand.  

The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5´.  

Whenever we have a DNI molecule and we need to determine which strand is the coding one, we just need to look for the presence/absence of start or stop codons.

So, in the exposed example we have two strands, but we do not know yet which one is the coding one.

Conventionally, the first strand is always the coding one. However, let us analyze it by using the presence/absence of codons.

First-strand:

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

let us write it is 5´to 3´direction

5´- GCATAATGCGTGATCCCTAGGCA -3´

now let us identify the start and stop codons in 5´⇒3´direction.

  • Start codon ⇒ ATG
  • Stop codon ⇒ TAA, TAG, TGA

5´- GCATA<u>ATG</u>CGTGATCCCTAGGCA -3´ ⇒ 1 start codon at the beginning

5´- GCA<u>TAA</u>TGCG<u>TGA</u>TCCC<u>TAG</u>GCA -3´ ⇒ 3 Stop codons

Second strand: We will do exactly the same procedure

5’-TGCCTAGGAGGGATCACGCATT<u>ATG</u>C-3’⇒ 1 start codon near the end

5’-TGCC<u>TAG</u>GAGGGATCACGCATTATGC-3’⇒ 1 stop codon at the beginning

What we did here was to identify in both provided strands, where the start and stop codons are placed. We can see that in the first strand we have the start codon near the beginning, while in the second strand we have it near the end of the sequence. From this information, we can assume that the first strand is the coding one. <em>However, you need to know that some coding sequences do not have start and stop sequences, because they might correspond to a sequence in the middle of a gene.</em>

So, the sequence of the DNA coding strand with a 5-3 polarity is

5´- GCATAATGCGTGATCCCTAGGCA -3´

You might be interested in
What tends to happen after a mass extinction event? How are humans affecting the ability of this to happen?
GalinKa [24]

Answer:

Scientists have been concerned that human activities could cause more plants and animals to become extinct than any point in the past. Along with human-made changes in climate (see above), some of these extinctions could be caused by overhunting, overfishing, invasive species, or habitat loss

6 0
3 years ago
Dew point Definition.
Thepotemich [5.8K]
The atmospheric temperature (varying according to pressure and humidity) below which water droplets begin to condense and dew can form.
4 0
3 years ago
The Greek scientist Galen theorized that:
dimulka [17.4K]

Answer:

A. Food was turned into blood, and when it reached the heart it was mixed with air to make 'spirit.'

Explanation:

Galen believed a theory of pneuma. That is, he believed that blood contains "vital spirits" released into it by the brain.

6 0
1 year ago
Read 2 more answers
Anyone online from india????​
Fudgin [204]

YES I AM ONLINE FROM Delhi, INDIA....

5 0
3 years ago
Read 2 more answers
Which of the following terms refers to a person's ability to reason speedily and abstractly?
mina [271]

Answer:

d. Fluid intelligence

Explanation:

Fluid intelligence -

It is the capacity to solve the problem in a novel situations and think logically and independence regarding the acquired knowledge .

The ability of fluid intelligence involves to determine the patterns and relationships which holds the novel problems and to assume these findings using logic .

Hence , the correct option for the given information is d. Fluid intelligence .

5 0
3 years ago
Other questions:
  • How does eutrophication cause fish to die
    5·2 answers
  • Need answer ASAP<br>if correct will give brainliest​
    6·2 answers
  • The arrow pathway from muscle to gray matter illustrated in Figure 1 below is called a(an) ____.
    9·2 answers
  • Nitrogen is released to the abiotic parts of the biosphere from the process of ___and___
    7·1 answer
  • Which of the following can increase genetic variation during meiosis
    15·1 answer
  • The fluid that surroundeds all cells in the body is konw as. ​
    12·1 answer
  • During the process of allopatric speciation, after geographic separation has occurred, what process would be a necessary last st
    7·1 answer
  • What are some functions of the plasma membrane?
    6·1 answer
  • What happens during the stage labeled 6?
    12·2 answers
  • What is the natural source of energy in Mars, please help
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!