1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mariana [72]
3 years ago
12

Enter the sequence of the DNA coding strand with a 5-3 polarity. DO NOT WRITE 5 OR 3 OR 5' OR 3' IN THE BOX!

Biology
1 answer:
Charra [1.4K]3 years ago
8 0

Complete question:

Use the sequence below to answer the following questions  

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’  

5’-TGCCTAGGAGGGATCACGCATTATGC-3’  

1. Enter the sequence of the coding strand with a 5’-3’ polarity

Answer:

coding strand → 5´- GCATAATGCGTGATCCCTAGGCA -3´

Explanation:

When referring to the <u>coding strand</u>, we are talking about the sequence that turns to be the same as the mRNA that results from the transcription of the same DNI segment -switching bases T for U-.  

The coding strand receives that name because it is the sequence that codes for each amino acid composing the proteins.

When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand.  

The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5´.  

Whenever we have a DNI molecule and we need to determine which strand is the coding one, we just need to look for the presence/absence of start or stop codons.

So, in the exposed example we have two strands, but we do not know yet which one is the coding one.

Conventionally, the first strand is always the coding one. However, let us analyze it by using the presence/absence of codons.

First-strand:

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

let us write it is 5´to 3´direction

5´- GCATAATGCGTGATCCCTAGGCA -3´

now let us identify the start and stop codons in 5´⇒3´direction.

  • Start codon ⇒ ATG
  • Stop codon ⇒ TAA, TAG, TGA

5´- GCATA<u>ATG</u>CGTGATCCCTAGGCA -3´ ⇒ 1 start codon at the beginning

5´- GCA<u>TAA</u>TGCG<u>TGA</u>TCCC<u>TAG</u>GCA -3´ ⇒ 3 Stop codons

Second strand: We will do exactly the same procedure

5’-TGCCTAGGAGGGATCACGCATT<u>ATG</u>C-3’⇒ 1 start codon near the end

5’-TGCC<u>TAG</u>GAGGGATCACGCATTATGC-3’⇒ 1 stop codon at the beginning

What we did here was to identify in both provided strands, where the start and stop codons are placed. We can see that in the first strand we have the start codon near the beginning, while in the second strand we have it near the end of the sequence. From this information, we can assume that the first strand is the coding one. <em>However, you need to know that some coding sequences do not have start and stop sequences, because they might correspond to a sequence in the middle of a gene.</em>

So, the sequence of the DNA coding strand with a 5-3 polarity is

5´- GCATAATGCGTGATCCCTAGGCA -3´

You might be interested in
The function of DNA is to code for
adelina 88 [10]
Deoxyribonucleic acid (DNA) is a nucleic acid that contains the genetic instructions for the development and function of living things. All known cellular life and some viruses contain DNA. The main role of DNA in the cell is the long-term storage of information.
7 0
3 years ago
The graph below shows the population change of a reintroduced species of marine organisms. Which is the most likely characterist
tester [92]

Answer:

c just did the test

Explanation:

i just did the test

5 0
2 years ago
Blood returning from the body (systemic circulation) first enters which chamber of the heart?
miskamm [114]
Right atrium because
5 0
3 years ago
Which criterion is used to functionally classify neurons?
Amanda [17]
<span>The direction the nerve impulse travels relative to the central nervous system.

I hope this helps!</span>
7 0
3 years ago
Estimate the maximum time a person could listen to a sound of 87 decibels.
Kazeer [188]

The maximum time a person could listen to a sound of 87 decibels is: 8 hours

<h3>Meaning of Decibels</h3>

Decibels can be defined as the unit used by scientists to measure sound level.The values of Decibel ranges from a very low value to a very high value and the higher we get the more dangerous it is to our human ear.

In conclusion, The maximum time a person could listen to a sound of 87 decibels is 8 hours

Learn more about Decibels and human hearing : brainly.com/question/1291668

#SPJ1

4 0
1 year ago
Other questions:
  • In a test of the effectiveness of garlic for lowering cholesterol, 48 subjects were treated with garlic in a processed tablet fo
    7·2 answers
  • Oxygen is released as a waste product by plants during the process of
    15·2 answers
  • Mineral deposits in streams may be extracted by which method?
    10·2 answers
  • Mitochondria and chloroplasts are two types of
    6·2 answers
  • There is enough renewable energy available given current technologies to meet
    11·2 answers
  • Help needed How skin is involved in homeostasis? Explain with the help of examples.
    14·1 answer
  • Which plant structure is most like the hyphae of fungi
    12·2 answers
  • What is the expected phenotypic ratio from a cross of heterozygotes (A1A2 x A1A2) for a phenotype that expresses incomplete domi
    11·1 answer
  • Explain how genes are expressed for a particular<br> trait.
    5·1 answer
  • The percentage of crossing-over between 4 linked genes (K, L, M, N) are below. Put them in the correct sequence.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!