Answer:
The cell's shape depends in part on the structure and composition of the extracellular matrix.
The size that the cell grows to depends in part on the polysaccharides in the extracellular matrix.
Explanation:
The extracellular is a suspension of macromolecules that supports the local tissue growth and maintain organs. The extracellular matrix directs the morphology of a tissue.
The extracellular matrix stores cellular growth factors, which are released locally based on the physiological needs of the local tissue.
The extracellular matrix transduce signals into cells, which regulate cellular functions such as growth, proliferation, migration, differentiation, etc.
The correct answer is TTAATCCTCGGGTCGAAACGGCT
This is because whenever you’re trying to find the complementary sequence of DNA, you basically switch which the listed base and it’s correspondent.
Adenine -> Thymine
Cytosine -> Guanine
Hope this helps!! :)
Answer: volcanoes and sea floor spreading
Explanation:
Answer:
- Proteins have the ability to change their conformation in order to establish multiple types of interactions
- Proteins are macromolecules that are large enough to cross the membrane of biological cells regardless of different regional polarities and they may act as pores through which molecules diffuse.
- Proteins have well-defined domains with amino acid residues whose R-groups contain both polar and nonpolar portions and thereby they interact with surrounding molecules according to their requirements.
Explanation:
Porins are a type of protein that cross the cell membrane and thus act as pores through which molecules can diffuse. Aquaporins are porins that form pores across the cell membrane and allow the transport of water molecules between cells. These proteins consist of six transmembrane α-helices embedded in the cell membrane. Aquaporins have five loop regions that enter and exit the cell membrane, and two of these regions are hydrophobic.
Answer:
The answer is alcohol.
Explanation:
It is not benzene, meth, and tobacco smoke.