1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leya [2.2K]
3 years ago
9

What do our muscles produce when undergoing anaerobic respiration?

Biology
1 answer:
agasfer [191]3 years ago
4 0

Answer:

Explanation:

Lactic acid fermentation In this type of anaerobic respiration, glucose is split into two molecules of lactic acid to produce two ATP. It occurs in certain types of bacteria and some animal tissues, such as muscle cells.  This process also produces two ATP per sugar molecule

You might be interested in
The information contained in the table could be used _______________________.
Stells [14]

Answer:

d

Explanation:

8 0
3 years ago
Read 2 more answers
List 4 chordate characteristics.
jek_recluse [69]

Answer:

notochord, dorsal hollow nerve cord, pharyngeal slits, and a post-an4l tail

Explanation:

had to censor second to last word but the 4 is an a

4 0
2 years ago
Please help really need this:
Agata [3.3K]
I think the answer is 100 per so C. hope it helps hanna
3 0
3 years ago
Planets are round because of gravity.<br> O True<br> O False
jok3333 [9.3K]
Answer:
True, planets are round because of gravity
7 0
3 years ago
Which cell feature is responsible for making proteins?
dexar [7]

The answer is B

Ribosomes

8 0
3 years ago
Other questions:
  • What do the liches and mosses produce to break down rocks to begin the formation of soil?
    11·1 answer
  • Identify the structure of the human heart that rises from the pulmonary trunk, connects to the left lung, and conveys venous blo
    9·2 answers
  • The students in Mrs. Cosby's class were observing worms. The students wanted to find out if a worm's body weight is related to h
    13·2 answers
  • Independent assortment occurs only in cells that are heterozygous for two genes (AaBb) and not in cells that are completely homo
    15·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • What genes control cell differentiation during development?
    14·1 answer
  • What does an epidermis look like
    11·1 answer
  • Question 15 (1 point) Which of the following demonstrates positive phototropism? bean plants twisting around a bean pole 12 a ho
    11·1 answer
  • 2. The volume of water in the pot decreases during this investigation. Water droplets form on
    11·1 answer
  • The installation of hands-free sinks is first required for which biosafety level?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!