1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
statuscvo [17]
2 years ago
9

I’ll mark brainiest if your right need ASAP

Biology
2 answers:
Gemiola [76]2 years ago
6 0

Answer:

D: Bb

Explanation:

FromTheMoon [43]2 years ago
4 0

Answer:

bb

Explanation:

Bro, I can't explain because anything I say says that it contains a link

actually I don't even look this up bc I already learned this so my bad

You might be interested in
I have no clue.....hate biology tho :3
omeli [17]
The answer is B.....
4 0
2 years ago
Frog lungs are poorly developed. How does this relate to their skin being thin and moist?
12345 [234]
Because of underdeveloped lungs the frog has to breathe through moist skin. Therefore for exchange of gases the skin is thin and moist
7 0
3 years ago
Is your ear canal connected to your brain?
Lana71 [14]
Yes, your ear canal is connected to your brain.
7 0
3 years ago
In angiosperms, the seeds are found in the _________
VladimirAG [237]

Answer:

d

Explanation:

4 0
2 years ago
Cell membranes are often called a "fluid mosaic" of lipids and proteins. What is the role of the cell membrane structures? Struc
dedylja [7]
A .Structurally support the cell 
B.Store nutrients for the cell to consume 
C. Produce ATP to provide energy for the cell 
D. Selectively allow some materials into the cell

It would be A

The Cell membrane is like a wall it allows things to pass though regulated.


Hope that helps
8 0
3 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • A cat is discovered with a very short tail. What would prove that this change was caused by a genetic mutation and not because t
    6·2 answers
  • You are on a field trip and are recording the salinity levels of the water. What are you measuring?
    11·1 answer
  • To prevent burglaries, your house door should remain<br> at all times.<br> locked<br> unlocked
    10·2 answers
  • Which of the following is true about the properties of aqueous solutions?
    5·1 answer
  • Which describes how mrna is used by a cell
    15·1 answer
  • Where did dogs come from?
    11·1 answer
  • access the capabilities of animal and plant cell types owing the presence or absence of chloroplast and cell wall
    10·1 answer
  • As compared to the neanderthals, middle stone age fossil humans found in africa reflect more:______
    15·1 answer
  • Help with question 2. A B &amp; C. the gizmo is Cell Types
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!