1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Naddika [18.5K]
2 years ago
7

Color in poison dart frogs is controlled by a single gene with multiple alleles. A blue poison dart frog that is heterozygous fo

r the blue allele (Cb) and red allele (Cr) is crossed to a yellow poison dart frog that is heterozygous for the orange (Co) and yellow (Cy) alleles. Their progeny are 1/2 blue, 1/4 orange, and 1/4 yellow. Determine the order of dominance for the alleles. (Order of dominance is indicated as: A > B > C > D such that A is dominant over all alleles, B is dominant over C and D, C is dominant only to D, and D is recessive to all alleles.)
Biology
1 answer:
8_murik_8 [283]2 years ago
7 0

Answer:

Cb>Cy>Co>Cr

Explanation:

First of al we need to do the Punnett square. As a result we get the genotypes:

CyCb

CyCr

CoCb

CoCr

Because there are no red frogs, red is the least dominant as it isn't expressed in any genotype.

Half of the progeny are blue and half of the possible genotypes contain the blue allele meaning that blue is expressed in all genotypes. This means that blue is the most dominant.

The only alleles left are yellow and orange. We can deduce that yellow is more dominant than orange because one of the parent frogs is yellow and contains the genes for yellow and orange.

As a result blue is the most dominant, yellow is the second most dominant, orange is the third most dominant and red is the least dominant.

You might be interested in
In their first attempts to genetically engineer a cow that will make and secrete human growth hormones in milk, scientists found
Arte-miy333 [17]

Answer:

C. The cows will reproduce, but neither males nor females will reproduce the altered gene.

Explanation:

I just had this question lol but because it said in the question “However, they discovered that the altered gene gets lost from the genome during meiosis.” Shows that the cows aren’t able to reproduce the altered gene. It never stated they can’t reproduce.

3 0
3 years ago
When considering the evolutionary tree of life and the three domains of life, which statement best describes what likely happene
Fudgin [204]

Answer:

The answer is - Although their cell structures are very different, archaean and  eukaryotic cells are more closely related to each other than to  bacteria, as evidenced by the fact that Bacteria was the first  domain to split from the shared ancestor of Archaea and  Eukarya.

Explanation:

The options are:

A. Bacterial and eukaryotic cells are more closely related to  each other than to archaeans, as evidenced by the fact that  bacteria and eukaryotes do not inhabit the most extreme  environments.

B. Although their cell structures are very different, archaean and  eukaryotic cells are more closely related to each other than to  bacteria, as evidenced by the fact that Bacteria was the first  domain to split from the shared ancestor of Archaea and  Eukarya.

C. Bacteria and archaeans are more closely related to each other  than to eukaryotes, as evidenced by their cell structures. Bacteria  and archaeans are prokaryotic, while all eukaryotic cells contain  mitochondria and other membrane-bound organelles.

D. The three domains of life are equally divergent from one  another, so no two domains are more closely related to each other.  This is supported by the evolutionary tree of life because three  branches extend from one node millions of years ago.

The answer is - B. Although their cell structures are very different, archaean and  eukaryotic cells are more closely related to each other than to  bacteria, as evidenced by the fact that Bacteria was the first  domain to split from the shared ancestor of Archaea and  Eukarya.

Archaea and bacteria are similar in terms of cellular organisation and size but are however similar to eukaryotes (eukarya) at the molecular level. Archaea and Eukaryotes both undergo DNA replication and protein synthesis the same mechanism. Both of them posses closely related genes and several metabolic pathways, including the enzymes in transcription and translation.

4 0
3 years ago
Which of the following does a flatworm do to obtain its food
nydimaria [60]
Through cells on the surface of its body and also through the orifice at the top of its head

7 0
3 years ago
If all 5' and 3' splice sites were always used to process the pre-mRNA into mRNA, how many possible distinct mRNA sequences woul
lord [1]

The question lacks the diagram. The diagram has been attached below.

Answer:

1.

Explanation:

Exons may be defined as the coding region of the RNA whereas introns are the non coding region of the RNA. The introns must be removed out from the RNA to makes it functional molecule.

The splicing of the given molecule results in the formation of single mRNA. The 1 splicing of the introns remove intron A whereas the second splicing results in the removal of intron B. The functional mRNA consists of the mRNA with exon 1,2 and 3.

Thus, the answer is 1.

6 0
3 years ago
Mrs. Jorgensen keeps a flock of chickens in her back yard. One of the roosters is the result of selective breeding by Mrs. Jorge
elena-14-01-66 [18.8K]

Answer:

Ostrich nevermind dont put  that

Explanation:

5 0
3 years ago
Other questions:
  • What is the benefit of groundnut in the body?
    15·1 answer
  • Hungaaroons can have straight hair, wavy hair, or curly hair. Straight hair is caused by having two of the same allele (SS). Cur
    5·1 answer
  • Which of the following is produced by adding 1% to 5% agar to nutrient broth that is then boiled and cooled?
    7·2 answers
  • Which domain would hagfishes, primitive vertebrates, be classified in?
    14·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Between which two atoms of water are hydrogen bonds are formed?
    13·1 answer
  • Abdullah repeatedly sees his physician for symptoms including paresthesias and "swelling" of the hands
    12·1 answer
  • Unlike b cells, t cells do not display antigen receptors on their surface membranes
    6·2 answers
  • ONLY DO NUMBER 5 I CAN DO THE REST....If you help i will pass you the brainliest.....Please help
    6·1 answer
  • Using scientific language explain first why the earth goes through seasons (winter, spring, summer, fall) and then explain speci
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!