1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lisov135 [29]
2 years ago
7

Which enzyme activate vitamin K in the liver and blocked by which drug?

Biology
1 answer:
frosja888 [35]2 years ago
6 0

Answer:

menadione

Explanation:

Vitamin K is a fat soluble vitamin that exists in two natural forms: phytonadione (K1: fye toe" na dye' one) which is derived from plant sources and menadione (K2: men" a dye’ one) which is derived from bacterial sources. Vitamin K is a cofactor in the photosynthetic electron-transport system in green plants, which are the major dietary source of vitamin K for humans. High levels of vitamin K1 are found in leafy green vegetables while vitamin K2 is found in meat, milk and butter. In humans, vitamin K is an essential cofactor in the gamma-carboxylation of glutamate residues of several clotting factors and anticoagulant proteins. Hope this helps!

You might be interested in
If two organisms belong to the same family, what other taxonomic groups do the organisms have in common
Amanda [17]

Explanation:

Even they to belong to the same Kingdom, Phylum,Class and Order.

this is the answer

<em><u>I </u></em><em><u>guess</u></em><em><u> this</u></em><em><u> </u></em><em><u>might</u></em><em><u> help</u></em><em><u> u</u></em>

3 0
3 years ago
Read 2 more answers
A historian is reading a book of ancient history that describes a plant bred for long, leafy flower buds that never open, result
guajiro [1.7K]

Answer: cauliflower

Explanation: i just did it on savvas

4 0
2 years ago
Which is produced immediately after a plant sperm cell fertilizes an egg cell?
Katyanochek1 [597]
A zygote is immediately formed after fertilization between two gametes. This cell is eukaryotic and made up of a combination of the DNA in both gamete. Zygote contains all the hereditary information essential in the formation of a new individual.
6 0
3 years ago
Rick is a biologist who predicted that squid would swim faster in warm water than cold water. Rick conducted his experiment, but
vaieri [72.5K]
<span>Report his findings because you cannot change your prediction and cannot throw away notes you must report the findings.</span>
4 0
3 years ago
Read 2 more answers
The table below describes two parts of a cell.
Lelechka [254]
A) part a is cell wall part b is chloroplast
6 0
3 years ago
Other questions:
  • Are substances able to travel against their concentration gradient
    12·1 answer
  • Is human height inherited or acquired? 
    15·1 answer
  • Is the sun indestructible, if it is, why? If not, why not?
    7·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • What was the purpose of Mendel's experiments with dihybrid crosses?
    14·1 answer
  • What factors might increase or decrease the probability of a species going extinct?
    11·1 answer
  • A __________ solution is a medium in which the overall concentration of solutes equals that found inside the cell. water enters
    6·1 answer
  • A government official who gives jobs to those who supported his or her campaign is engaging in what type of behavior?
    13·1 answer
  • Creation of an unnatrually uniform sample to representt a diverse population can be avoided by
    6·2 answers
  • A new pest is found that only feeds on corn plant leaves. Livestock eat corn cobs. Which promoter would you choose if the modifi
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!