1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
deff fn [24]
4 years ago
5

What could be some weakness with using a test cross to determine Fred’s genotype?

Biology
1 answer:
Komok [63]4 years ago
6 0

Answer:

Test-cross is often used to determine the genotype of parent that is dominant as we cannot determine that the dominant parent is homozygous or heterozygous for the trait just be looking at it.

In a test-cross, the dominant trait organism will be crossed with a recessive type organism. The results will predict the genotype of the dominant parent.

<u><em>Some of the drawbacks of the test cross are:</em></u>

<u><em>a) It might be difficult to find a recessive type of the particular trait.</em></u>

<u><em>b) The result prediction can take a lot of time. This is because enough offspring have to be developed to predict the result which will take time. </em></u>

<u><em></em></u>

<u><em></em></u>

You might be interested in
What format is typically followed with
Evgen [1.6K]

Answer:

C.

Explanation:

A hypothesis is always in the form of an if, then statement.

6 0
2 years ago
When an organism such as a yeast lives by fermentation, it converts the pyruvate from glycolysis into a different compound, such
Dahasolnce [82]

Answer:

The conversion is needed to regenerate the molecules needed for glycolysis

Explanation:

Fermentation is a metabolic process by which microorganisms generate ATP by the anaerobic (without oxygen) degradation of organic nutrients. Fermentation allows to microorganisms convert carbohydrates into alcohol or acid. During glycolysis, two NAD+ molecules are reduced and glucose molecules are split into two pyruvate molecules, thereby producing two NADH molecules and two ATP molecules. During fermentation, pyruvate molecules are metabolized to different compounds because the energy stored in the pyruvate molecules is unavailable to the cell. In fermentation, NADH from glycolysis is oxidized back to NAD+ by being used to reduce pyruvate or a pyruvate derivative.

4 0
3 years ago
Clouds form by the condensation of...
Yuri [45]

Answer:

a

Explanation:

clouds form when water rises as water vapor and cools and condenses into clouds

4 0
3 years ago
The _____________ have(has) many productive coalfields in West-Central Europe. A- navigable river B- English Channel C- North Se
den301095 [7]
Your answer :P > <span>D- Central Uplands</span>
7 0
3 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Other questions:
  • Development is defined as an increase in the number of cells
    8·1 answer
  • What is the maximum number of electrons in the 1s orbital of an atom?
    15·1 answer
  • How is a water shed different from a tributary<br>​
    6·1 answer
  • What type of energy can a peanut butter and jelly sandwich give you
    13·2 answers
  • Which of the following would be most likely if the proteins embedded in a cell membrane were unable to function properly?
    15·1 answer
  • A nurse is admitting a new client on the mental health unit. during the conversation the nurse should be aware that countertrans
    6·2 answers
  • Which best represents homostasis, energy, humans, balance?
    15·1 answer
  • What is the importance of sustainable agriculture?
    12·1 answer
  • Define phanerograms with examples.​
    7·1 answer
  • Some organisms have genes that improve their ability to survive
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!