1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anarel [89]
3 years ago
7

Amniocentesis is a process in which amniotic fluid is taken from the mother's womb to identify any genetic abnormalities in the

fetus. how would the discovery of the human genome contribute to this process?
a.the defective gene can be replaced with its normal counterpart.

b.the exact location of a particular disease-causing gene can be determined.

c.scientists will be able to detect new genes, causing other genetic disorders.

d.scientists can block the action of defective genes and arrest any genetic abnormalities.
Biology
2 answers:
Yuri [45]3 years ago
6 0
<h2>Answer:</h2>

The correct answer is option B which is, " the exact location of a particular disease-causing gene can be determined".

<h3>Explanation:</h3>
  • <u>Premature genetic testing is the method to identify the different genetic anomalies in the baby before birth by testing the amniotic fluid.</u>
  • First, the fluid is taken and embryonic cells are separated from the fluid and then genome, DNA is separated.
  • Then the genome of the baby is compared with the discovered human genome.
  • The defected gene is then identified with its location in the genome.
  • Hence in genetic testing discovered human genome is used to identify the location of the defected gene.
Zarrin [17]3 years ago
4 0
<span>B)<span>The exact location of a particular disease-causing gene can be determined.

</span></span>
You might be interested in
What is shown in the imagine <br> prokaryote<br> eukaryote<br> chloroplast<br> mitochondrion
m_a_m_a [10]

"Prokaryote" is shown in the given image.

Answer: Option A

<u>Explanation:</u>

A prokaryote is a single-cell organism which is deficient in a membranous nucleus, mitochondria, or any other membranous organs. Prokaryotes are categorized into two domains: Bacteria and Archaea. At the third domain: Eukaryota, species with nuclei and organelles are located.

The asexual prokaryotes reproduce without fusion of gametes. They are considered as first living organisms. In the prokaryotes components like proteins, DNA and metabolites, overall the intra-cellular water-soluble components are enclosed by the cell membrane as situated together in the cytoplasm, rather than in separate cellular compartments.

6 0
3 years ago
What must be true about the number of chromosomes in each sex cell (when compared to the number of chromosomes in body cells
Mamont248 [21]

Answer:

The number of chromosomes in sex cell must be haploid (1n) as compared to body cell which is diploid(2n).

Explanation:

Body cells are diploid while the sex cells are haploid. We can say that sex cells contain half number of chromosomes as compared to body cells.

6 0
3 years ago
If T = tall and t = short for a pea plant, what would a pea plant that has Tt as its alleles for that trait look like ?
Vikentia [17]

Answer:

<u>B. Tall</u>

Explanation:

since an allele that's paired with a dominant allele has no effect on the organism.

5 0
3 years ago
Read 2 more answers
You observe a cell in a stained section of connective tissue. The cell has an indented nucleus and obvious cytoplasmic granules.
defon
You observe a cell in a stained section of connective tissue. The cell has an indented nucleus and obvious cytoplasmic granules. Upon further testing, you determine that the granules contain histamine. This cell is most likely a(n) _____.

mast cell
3 0
3 years ago
A researcher discovers two populations of birds that are similar. The two populations live in habitats that are different. What
faltersainse [42]
We may lead to a presupposition that the researcher based its analysis on the environmental habitats of the organisms, moreover it can also be the almost identical but different morphological or physiological structures. There are many ways to classify an animal or base an animal, morphology, embryology, DNA and others. 
3 0
3 years ago
Read 2 more answers
Other questions:
  • What structure surround and protect the cell?
    13·1 answer
  • A nurse is asked which mineral calcitonin and parathyroid hormone regulate. how should the nurse respond?
    10·1 answer
  • Why an ecosystem requires a constant input of energy
    15·1 answer
  • What does sonar equipment measure
    15·2 answers
  • What group of protists can be autotrophic, heterotrophic, or both
    12·1 answer
  • What’s the largest shark specie?
    14·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • How are photosynthesis and cellular respiration similar?
    8·1 answer
  • What does an alcoholic beverage contain that is a central nervous system depressant? 
    10·2 answers
  • What are the characteristic of solute plssss po​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!