1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zalisa [80]
3 years ago
8

In Marker Analysis, how are STRs related to alleles? Be sure to define each term (STR and allele) and explain how the two result

in different band patterns when run in gel electrophroresis.
Biology
1 answer:
Lisa [10]3 years ago
3 0

Answer:

The number of STR repeats is unique and therefore it is considered as an allele of that <em>locus</em>

Explanation:

Short Tandem Repeats (STRs), also known as microsatellites or simple sequence repeats (SSRs), are short DNA sequences with a size of 1-6 nucleotide bases which may be many times repeated in tandem. STRs localize in specific regions of the genome (<em>loci</em>) and therefore they are molecular markers. Gel electrophoresis a technique used to separate DNA fragments based on their size. In consequence, the pattern of STR repeats or 'alleles' obtained by electrophoresis can be used to identify individuals. In a gel electrophoresis, STR markers produce different bands that run more slowly or faster on the gel in different lanes according to their size (e.g., more slowly >> higher size of the STR sequence), and thereby STR alleles are unique and serve to identify individuals.

You might be interested in
The green "s c u m" you see in an aquarium is called _____.
Setler [38]

Answer:

b. cladophora

Explanation:

The cladophora algae is a type of green algae that grows attached to rocks or wood that are underwater. It forms short, rigid green filaments that branch, it's smell is similar to mushrooms. The cladophora is introduced in aquariums via contaminated plants or equipment, therefore to prevent it's formation it is necessary to clean everything before intoruducing it to the aquearium. This algae is so resistant once installed that usually the tank has to be re-started.  

8 0
3 years ago
All of the following affect the speed of sound underwater except
Vinil7 [7]
I think it is light so B) light
8 0
4 years ago
Robert experienced bradycardia, or slowing of the heart rate, after using certain eye drops prescribed to him for his glaucoma.
just olya [345]

He is experiencing an overdose of drugs to treat could occur if they are taken improperly, or if decreased liver or renal function occurs. Symptoms of overdose include severe nausea/vomiting, sweating, salivation, hypotension, bradycardia, convulsions, and increased muscle weakness, including respiratory muscles. This patient has diabetes and thus may have glycaemic issues. Bradycardia and muscle weakness.  Abdominal pain and dry mouth. Tachycardia and hypertension.  Emotional withdrawal and tachypnea.

6 0
3 years ago
Read 2 more answers
You perform a series of experiments on the synthesis of the pituitary hormone prolactin, which is a single polypeptide chain 199
Schach [20]

Answer:

the answer is dont look it up anymore figure it out

Explanation:

7 0
3 years ago
Describe how ATP is generated in the light reactions​
arsen [322]

The Light Reactions of Photosynthesis. Light is absorbed and the energy is used to drive electrons from water to generate NADPH and to drive protons across a membrane. These protons return through ATP synthase to make ATP.on:

4 0
2 years ago
Other questions:
  • What are the three interactions that can occur when amino acids are close to each other?
    5·1 answer
  • Complains of a dry mouth. the medical term for this condition is
    6·1 answer
  • Your patient has suffered a severe electrical burn. when caring for electrical burn​ injuries, you should​ never:
    12·1 answer
  • Was the creation of sandman a result of weathering or erosion? Explain your answer.
    15·1 answer
  • Which part of an amino acid is the only one that varies and is what defines its properties? A. The amino group B. The R group C.
    13·2 answers
  • A test cross can be used to _____.
    10·2 answers
  • Imagine you were going to build a “green” building. What features would it have? What would it look like? How would it harmonize
    6·1 answer
  • CAN I PLZ HAVE SOME HELP!!!! DUE TO NIGHT<br> choose answer chose (ROW 1 , ROW 2 , ROW 3 , ROW 4)
    13·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Write the relationship between cells, tissue and organs in human body.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!