1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KatRina [158]
3 years ago
15

Match the images with the correct fossil type​

Biology
1 answer:
vlabodo [156]3 years ago
8 0

Answer:

A. Trace, b. Cast, e. Mold, c. Carbon film, d. Petrified

Explanation:

God bless and stay safe and im very sorry if this is wrong.

You might be interested in
Pls help thankssssssss
frez [133]

most of the answers are on here https://quizlet.com/78911237/bio-test-on-the-cell-membrane-osmosis-and-diffusion-8b-flash-cards/ just scroll down!!


7 0
3 years ago
Analyze the given diagram of the carbon cycle below. An image of carbon cycle is shown. The sun, a cloud, two trees, one on the
stiks02 [169]

Answer:

where is the image...please

3 0
3 years ago
Which step occurs in meiosis to prepare for fertilization in sexually reproducing organisms?
Rama09 [41]
12 sexual reproduction and meiosis concept outline
4 0
3 years ago
Read 2 more answers
The diagram shown below represents the enzymatic processes involved in a chemical
Tju [1.3M]

Answer:

lock and key method ?

Explanation:

4 0
3 years ago
Read 2 more answers
Which of the following factors would NOT be a source of competition between a wolf and a bear?
jeyben [28]
I believe the answer should be mates...(2)
4 0
3 years ago
Other questions:
  • Which temperature on the Celsius scale corresponds to 257 K on the Kelvin scale? K = °C + 273 A) -16 °C B) -26 °C C) 273 °C D) 5
    7·2 answers
  • What is the correct answer ? explain why and please answer this !!
    8·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Responda ciências pfvv
    5·1 answer
  • PLEASE HELP DUE IN 20 MINUTES
    12·2 answers
  • Which symbol represents a hybrid?<br><br><br> Aa<br><br> dE<br><br> BB<br><br> cc
    13·1 answer
  • Which best describes a gene?
    11·1 answer
  • Describe an experiment that would allow you to determine if it is warmer inside or outside the playhouse by using two similar cu
    11·1 answer
  • The coagulation of
    6·1 answer
  • A biology class is studying the concept of carrying capacity. On a field trip, the
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!