As the earth revolves around the sun, the earths axis is pointed at

slamgirl [31]

Answer:

Explanation:

chemical energy

The overall purpose of the light-dependent reactions is to convert light energy into chemical energy. This chemical energy will be used by the Calvin cycle to fuel the assembly of sugar molecules. The light-dependent reactions begin in a grouping of pigment molecules and proteins called a photosystem.

8 0

2 years ago

Which of the following instruments produces highly magnified images of a cell’s internal structure but cannot be used to examine

Llana [10]

Answer:

Transmission electron Microscope

Explanation:

It produces thin slices of photography and extremely tiny things. The disadvantages are that its expensive, and you cannot test living things with it, its also massive

8 0

3 years ago

The number of cells in an average-sized adult human is on the order of 10^14 cells. Use this information, and the estimate that

KengaRu [80]

IF:
Number of cells: $C = 10^{14}$
DNA lenght: $D = 2m = 12.42 * 10^{-4} mi$
Distance from Earth to Sun: $ES=93000000 mi = 9.3* 10^{7}mi$

Then:
a) <span>Over how many miles would the total DNA from the average human stretch?
The answer is product of multiplication of the number of cells (C) and the DNA length (D):
Total DNA: </span> $T = C*D$
⇒ $T = 10^{14}*12.42* 10^{-4} mi$
⇒ $T = 12.42* 10^{14-4} mi$
⇒ $T = 12.42* 10^{10} mi$
The total DNA from the average human will stretch $12.42* 10^{10} mi$

b) How many times would the total DNA from the average human stretch from Earth to the Sun and back?
The answer is concluded from the ratio of the total DNA length (T) and the <em>twice </em>(because of stretch to the Sun and back, thus, <em>two directions</em>) of distance from <span>Earth to the Sun (ES) and :
Ratio: </span> $R= \frac{T}{2*ES}$
⇒ $R = \frac{12.42* 10^{10}mi }{2*(9.3* 10^{7}mi)}$
⇒ $R = \frac{12.42* 10^{10}}{18.6*10^{7}}$
⇒ $R = 0.6677* 10^{10-7}$
<span> ⇒ $R = 0.6677* 10^{3}$
</span><span> ⇒ [tex]R = 667.7
</span>Thus, 667,7 times will the <span>total DNA from the average human stretch from Earth to the Sun and back.</span>

6 0

3 years ago

Why is it colder in winter than summer?

iragen [17]

One reason is because the short days and long nights prevent the earth from warming up, another reason could be because the sun's rays in winter are more spread out thus minimizing the amount of energy

6 0

2 years ago

Read 2 more answers

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago