1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Doss [256]
3 years ago
8

Watson's book is credited for helping to give the public a greater appreciation for science and a better understanding of what s

cientists actually do.
O True
O False​
Biology
1 answer:
max2010maxim [7]3 years ago
6 0
I believe the answer is True
Hope this helps you have a great night!!!
You might be interested in
Why was charles darwin considered to be revolutionary?
jasenka [17]

Answer:

because the theory of evolution provided a competley naturalistic explanation of life without spiritual basis.

Explanation:

6 0
4 years ago
In which type of unconformity is the eroded rock tilted or folded?
Yuri [45]
A. disconformity. I hope i helped you.
8 0
3 years ago
Read 2 more answers
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
3 years ago
Suppose a dye for staining cells stains the region where ribosomes are made. what would you expect to see inside the stained cel
ella [17]

The RNA (ribonucleic acid) and the associated proteins forms the ribosomes. These ribosomes are the site of protein synthesis in a cell. Inside the stained cell nucleus, the nucleolus part of the cell can be seen. The nucleolus is the part where the all the ribosomes of the cell are assembled.

Hence, the answer is 'nucleolus'.

5 0
4 years ago
What are the cells that are primarily responsible for photosynthesis?
4vir4ik [10]

Answer: thylakoid membrane

Explanation:

8 0
4 years ago
Read 2 more answers
Other questions:
  • What could farmers do to prevent another potato famine?
    11·1 answer
  • As humans have converted prairies to pastures and farms, prairie dogs have lost 98 percent of their habitat. Ferrets depend comp
    7·2 answers
  • 1. the paths of winds and ocean currents curve because Earth rotates from west to east this curving of the path is called
    10·2 answers
  • “If left alone by humans, the populations of all organisms in an ecosystem will increase.”
    12·1 answer
  • Why are there two sets of phases during meiosis, but only one during mitosis?
    10·1 answer
  • Which substance would be extensively studied during a college organic chemistry course?
    6·1 answer
  • While brain efficiency can vary from person to person, certain activities seem to correlate with less cognitive decline. Which i
    6·1 answer
  • Tell me one thing that makes deoxyribonucleic acid (DNA) different from Ribonucleic acid (RNA).
    15·2 answers
  • How can the type of bedrock under soil affect the characteristics of the soil?
    8·1 answer
  • What are some limiting factors that occurs when species interact with each other?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!