1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Svetlanka [38]
3 years ago
10

How does the model of the electromagnetic spectrum benefit the study of science?

Biology
2 answers:
Molodets [167]3 years ago
8 0

Answer:

the answer is c

Explanation:

maw [93]3 years ago
6 0
Helps compare the application of electromagnetic wavelength

You might be interested in
The identity of the four DNA nucleotides is based on _______________________. A-nitrogen bases B-covalent bonds C- sugars D-phos
amid [387]
The identify of the four DNA nucleotides is based on b) covalent bonds.
7 0
3 years ago
Read 2 more answers
What is commensalism
IgorLugansk [536]

Answer:

An association between two organisms in which one benefits and the other derives neither benefit nor harm.

Explanation:

8 0
3 years ago
Read 2 more answers
Water molecules can establish weak ____________ with one another because they are ____________ (have a slightly positive end and
kolbaska11 [484]

Answer:

1.hydrogen bonds

7 0
2 years ago
Why is it essential to use a stain as part of the smear prep?
zubka84 [21]

Answer:

Tne most basic reason that cells ate stained is to enchance visualization of the cell or certain cellular components under a microscope.Cells may be also be stained to highlight metabotic processesor to differentiate between live and dead cells in a sample

hope it helps,and have a lucky day....

5 0
2 years ago
Complete the model of the lactic acid fermentation process.
Zina [86]
For the process of transformation of glucose into pyruvate, NAD⁺ is converted into NADH. These same NADH molecules are then reutilised on the pyruvate to lactic acid reaction and are therefore transformed back into NAD⁺ molecules that will again be used for another glycolysis reaction.
From the first rectangle, on the left, to the last rectangle, on the right, it comes NAD⁺ - NADH - NADH - NAD⁺.
5 0
3 years ago
Other questions:
  • What is a hypothesis?
    13·1 answer
  • \ would you be injured if you pulled a muscle in your axillary region, cracked a bone in your occipital region, or cut a digit?
    11·1 answer
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • Explain the significance of blast cells in the peripheral blood.
    12·1 answer
  • People with _____ of circadian rhythm sleep-wake disorder have sleep that tends to be fragmented into at least three periods per
    15·1 answer
  • A human skin cell has 46 chromosomes. How many chromosomes will each daughter cell have at the end of mitosis?
    6·1 answer
  • What information can a scientist learn directly from a single fossil?
    5·2 answers
  • To see if baldness is caused by a high protein diet, a scientist gives
    12·1 answer
  • I'm not sure?what it is and im stuck​
    15·1 answer
  • in pea plants , green peas are a recessive trait and yellow peas are a dominant trait , how can two plants with yellow peas prod
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!