1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Debora [2.8K]
3 years ago
14

Please help , thank you!

Biology
2 answers:
bogdanovich [222]3 years ago
7 0

Answer:

I think C based off the image you generously provided. (it makes me type 20 characters lol)

TiliK225 [7]3 years ago
4 0

Answer:

I think it's C

Explanation:

You might be interested in
Exposure to cocaine during pregnancy leads to increased risk of: select one:
uysha [10]
I believe it's A. Premature Birth (though they all seem pretty believable)
8 0
3 years ago
Please help me as soon as possible
miss Akunina [59]
7 bc it has more trees
8 0
3 years ago
The Clean Water Act funded the creation of which of the following?
attashe74 [19]

Answer:

Sewage Treatment Plants

Explanation:

Just did the test sorry its so late man.

6 0
3 years ago
Read 2 more answers
Recall that DNA is
Mashutka [201]

Answer:

25 nucleotide sequence pair

Explanation:

There are four nucleotide sequence pair present in DNA. and if we have 100 nucleotide so 25 nucleotide sequence pairs will be formed and each pair contains adenine (A), cytosine (C), guanine (G), and thymine (T).

Cytosine nucleotide paired with guanine nucleotide and Adenine nucleotide paired with thymine nucleotide . They have hydrogen bonds between each bases.  

6 0
3 years ago
This picnic table was made from fallen trees in a local forest. Is this picnic table a biotic or abiotic factor? Explain your an
slava [35]

Q: this picnic table was made from fallen trees in a local forest. is this picnic table a biotic or abiotic factor? explain your answer.

A: the answer would be biotic because the term biotic means that something is living or had lived before. as you can see, the table was made by fallen trees in the local forest. that means it lived before the tree was fallen and carved into a picnic table.

hope this helps! ❤ from peachimin

6 0
3 years ago
Read 3 more answers
Other questions:
  • HCG is secreted in the human female immediately after conception. How would a gynecologist use this information?to detect pregna
    15·2 answers
  • __________ helps organisms transport nutrients.
    5·2 answers
  • Plz help don’t get was not at school
    6·1 answer
  • Grasses → mice → cat → coyote As matter and energy move from grasses to coyotes the amount of available energy
    8·2 answers
  • How does segragation increase the genetic variability of sexually reproducing organisms?
    9·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Which organism below receives 10% of the available energy?
    9·1 answer
  • What is the difference between a predator and a parasite?
    8·1 answer
  • Use the periodic table to identify the chemical
    15·1 answer
  • Which statement accurately describes natural selection?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!