1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aleonysh [2.5K]
3 years ago
13

If a dam is removed, the river and estuary ecosystem will recover A True B False

Biology
2 answers:
Phantasy [73]3 years ago
7 0
Anwser: true
explanation:
Novay_Z [31]3 years ago
4 0

Answer:

true

Explanation:

You might be interested in
At one time, Heinz made its own brand of soups. The company also produced those same soups to be sold as store brands. The Heinz
elixir [45]

Answer:

D. Product differentiation

Explanation:

Product differentiation is the marketing strategy use by a company to distinguish similar products or services.

product differentiation strategy is the method which company uses to improves on a particular products over another, maybe due to competitor brand or consumer comments.

3 0
4 years ago
Describe the relationship between DNA, chromosomes, and genes.
malfutka [58]
DNA carries instructions for making the proteins a cell needs.DNA molecules are found in chromosomes.Genes are segments of DNA that contain instructions that code for proteins.

hoped this helped

4 0
4 years ago
Read 2 more answers
What happens before mitosis occurs?
Anit [1.1K]
I believe the answer is D. the genetic material of the parent cell multiplies into two sets
3 0
4 years ago
Read 2 more answers
Please help..How does Gregor Mendel's work demonstrate support for the concepts of dominant and recessive alleles?
baherus [9]
<span>Gregor Mendel used peas to conduct his experiments in genetics. He showed how different alleles gathered from each of the parents, when combined, would reemerge as various characteristics in the offspring.</span>
5 0
3 years ago
Which would lead to an increasing population?
irakobra [83]
Death rate is lower than birth rate, and immigration equals emigration would lead to an increasing population.
Option D is the correct answer
5 0
2 years ago
Other questions:
  • Tectonic plates are pieces of the ________ that float on the more semi-solid ________ below.
    15·1 answer
  • If the fat in a container is solid at room temperature, what type of fat is it?
    11·1 answer
  • The traditional view of mangrove forests as wastelands and unhealthy environments helped promote their degradation because _____
    7·1 answer
  • Which changes faster? weather or climate
    9·2 answers
  • What surgical procedure is used to treat varicose veins?
    12·1 answer
  • Land habbits contain majority of our organisms
    12·1 answer
  • True or false: phospholipids have hydrophilic and hydrophobic regions
    13·2 answers
  • Which plays the most important role in the movement of water through a plant – the absorption of water by the roots or the evapo
    9·1 answer
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
  • PLEASE HELP ASAP!!!!
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!