1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Solnce55 [7]
3 years ago
7

Who controls selective breeding?

Biology
1 answer:
Alex73 [517]3 years ago
8 0
I’m saying A but maybe not
You might be interested in
What is a ecological niche
asambeis [7]

Answer:In ecology, a niche is the match of a species to a specific environmental condition. It describes how an organism or population responds to the distribution of resources and competitors and how it in turn alters those same factors.

Explanation:

6 0
3 years ago
Read 2 more answers
Cattle egrets are seen moving around with cattle. Egrets benefit from this association because they receive food in the form of
fiasKO [112]
Commensalism is the right answer.
4 0
3 years ago
Read 2 more answers
I need help i dont understand
Neporo4naja [7]

Answer:

c

Explanation:

5 0
3 years ago
Read 2 more answers
Ari drew a diagram to show organisms in an ecosystem. What did Ari draw?
Alexandra [31]

Answer:

food web

Explanation:

Food web is an interconnection and assimilation of different good chains. Many food chains are interlinked a hence a food web is created. This represents what is eaten by which organism. The diagram that Ari had drawn is a diagram of a food chain. The grass is the primary source of food in the food web. Rabbit, Mouse, and grasshopper are the animals that eat the grass. The grasshopper is eaten by a shrew and a mouse. The rabbit and shrew are then eaten by the fox. A mouse is eaten by a snake and a fox. This is the diagrammatic representation of a food web.

5 0
3 years ago
As food becomes scarce, monkeys within the same tribe can fight for food resources. This behavior describe
MrRissso [65]

As food becomes scarce, monkeys within the same tribe can fight for food resources. This behaviour describes intraspecific competition.

<h3>What is intraspecific interactions?</h3>

Intraspecific competition is a competition between someone from the same species . Theimpact of competition on each individual within the species relies on the type of competition that takes place.

'The competition' may be inactive or active and may result in ovarious outcomes.

Thus, This behaviour describes intraspecific competition.

To learn more about intraspecific competition click here:

brainly.com/question/17003911

#SPJ1

5 0
2 years ago
Other questions:
  • How many dna molecules are present in a synapsed pair of homologous chromosomes?
    6·1 answer
  • The Great Ice Age occurred during the _________.
    8·2 answers
  • Reptiles are ectothermic yet they must still be able maintain a relatively high internal body temperature in order to function p
    8·1 answer
  • What is the best definition of a virus
    15·1 answer
  • Difference between symbolic and parasitic bacteria<br><br>​
    12·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • You okay baseball in a field where the grass is mowed all summer. What type of succession would occur if no one mowed the grass
    5·1 answer
  • If two glasses of water are at the same temperature the average blank​
    12·1 answer
  • Which level of cellular organization is represented by nerve tissue and muscle tissue
    6·1 answer
  • ASAP! ILL MARK BRAINLIEST
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!