1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
s344n2d4d5 [400]
2 years ago
5

Please identity each of these weed by their botanical names​

Biology
2 answers:
Lady_Fox [76]2 years ago
8 0

Answer:

I cannot see it properly , can you take a better picture???

Explanation:

sashaice [31]2 years ago
6 0

Answer:

  • neem
  • gulmohar
  • tulsi

hope it helps

You might be interested in
After our sweat mixes with our skin bacteria and we don’t shower soon, the result is
enyata [817]
When you aren't showering as regularly, your skin can become oily and salty leading to blemishes and breakouts. Although your skin can get all sweaty during the day anyway, not bathing means these bacteria are not being thoroughly removed or cleaned.
6 0
3 years ago
When is cladistics more useful than linnaean taxonomy
Lena [83]
Cladistics<span> is an approach used for biological classification in which organisms are categorized based on  their shared characteristics that can be used to traced to a group's most recent common ancestor.</span>
3 0
3 years ago
Read 2 more answers
Please help ASAP!!!
Harlamova29_29 [7]
I’m not sure. Im pretty sure it’s D.
6 0
3 years ago
Read 2 more answers
Lipids help to make up the cell membrane in all cells. How are lipids able to do this?
ASHA 777 [7]

Answer:

they have chemicals

Explanation:

5 0
3 years ago
Some salmon have been genetically modified to grow bigger and faster than wild salmon.
DIA [1.3K]

Answer:

B

Explanation:

They would grow bigger and faster, meaning they would quickly outcompete the native salmon for food, space, etc.

5 0
3 years ago
Other questions:
  • Give an example of a specialized leaf system that is adapted specifically to its environment and explain how it works.
    8·1 answer
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • "a condition in the brain, heart or other body arteries in which there is a bulge on the wall of the artery that can cause dange
    10·1 answer
  • What does a new cell need to function?
    6·2 answers
  • Which statement best explains why the development of a new area of science can lead to changes in a theory? A.A new area of scie
    14·2 answers
  • Classify the following material as mineral, gem, ore, or none. some may have more than one answer.
    10·2 answers
  • Leaves are important plant structures because they?
    12·1 answer
  • Which of the following is FALSE about elements?
    12·1 answer
  • A moon has less mass than a star and more mass than a planet it orbits.<br> •True<br> •False
    7·1 answer
  • When the atoms involved in a covalent bond have the same electronegativity, what type of bond results?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!